Skip Navigation


Human Molecular Genetics Advance Access originally published online on July 8, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/17/2229    most recent
ddg220v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Laurent, A.-M.
Right arrow Articles by Buard, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurent, A.-M.
Right arrow Articles by Buard, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 17 2229-2239
DOI: 10.1093/hmg/ddg220
© 2003 Oxford University Press

Recombination across the centromere of disjoined and non-disjoined chromosome 21

Anne-Marie Laurent1, Meizhang Li1, Stephanie Sherman2, Gérard Roizès1 and Jérôme Buard1,*

1Institut de Génétique Humaine, CNRS UPR 1142, Montpellier, France and 2Department of Genetics, Emory University School of Medicine, Atlanta, USA

Received May 21, 2003; Accepted June 25, 2003

DDBJ/EMBL/GenBank accession no. AF254982


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Meiotic recombination is generally suppressed across the centromere of eukaryotic chromosomes. In human, megabase-long satellite sequences and contiguous segmental duplications hamper both physical and fine scale genetic mapping in regions flanking centromeric DNA. We have developed polymorphic microsatellite markers embedded within the duplicated most proximal sequences of the long arm and of the short arm of chromosome 21 by using paralogous specific bases as anchor points for their specific detection. Segregation analysis in CEPH reference pedigrees shows that recombination is repressed significantly across the centromere of chromosome 21 both in male and in female but not in the most proximal 21q region in female. Extreme size variations of the alpha-satellite I blocks transmitted in these families and deduced from quantitative FISH analysis are not correlated with the inter-individual variations of recombination activity observed in the peri-centromeric region. Finally, none of 28 families with a trisomy 21 child previously associated with a nullitransitional meiosis I non-disjunction event presents a recombination exchange across the centromere. This confirms that, for this group of errors, the lack of recombination is the primary susceptibility factor, not abnormal recombination in the centromeric region.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Meiotic exchange is not distributed randomly along eukaryotic chromosomes. The most pronounced departure from uniformity is observed near centromeres and telomeres in a wide variety of plant and animal genomes. The centromere exerts a negative effect on recombination activity both within itself and in proximal regions (1).

In human, specific physical and genetic mapping efforts have shown that sex-average recombination rate per physical unit is reduced by at least one order of magnitude across the centromere of chromosome 10 (2), chromosome X (3,4), chromosome 5 (5) and in most proximal regions of chromosome 19 (6). This reduction is more intense in male with repression extending more than 5 Mb away from the three autosomal centromeres. Chromosome X analysis demonstrates that the centromere effect exists in female as well, with a 8-fold suppresssion across the centromere compared with the average rate of recombination along the whole chromosome (4).

Several kinds of redundant sequences, including megabase-long satellite DNA and contiguous segmental duplications, hamper the characterization of unique polymorphic markers within centromeric and juxtacentromeric regions respectively. Indeed, a typical juxta-centromeric region consists of a patchwork of contiguous genomic sequences duplicated on several non-homologous chromosomes with high levels of nucleotide identity between copies (79). This complexity accounts for the lack of reliable physical map and of chromosome-specific polymorphic markers for most juxtacentromeric regions.

In the absence of such tools, only genome-wide recombination maps and female-to-male genetic distance ratio could shed a light on the centromere effect in human. Metacentric chromosomes present a strong positive correlation between sex average recombination rates and the physical distance from centromere (1012). This correlation is mainly due to the centromeric repression in male that is 2–8-fold higher than in female. In contrast, no significant gender difference has been observed in the most proximal regions for acrocentric chromosomes except for chromosome 21, which behaves like a metacentric chromosome in this respect (10). A meta-analysis of recombination along 21q indicates that the female recombination rate is higher in the most proximal interval (4 cM/Mb) than along the rest of the chromosome (13) and strengthens previous reports showing no suppression of recombination within a 2.4 Mb 21q11.1 interval, 400 kb away from the centromeric alphoid tandem repeats (14). However, the proximal boundaries of these maps consist of microsatellite elements located within the duplication-rich juxtacentromeric region. Whether the microsatellite typed for each CEPH parent is actually located in 21q11.1 thus remains uncertain. Characterization of chromosome-specific marker in this region could confirm this unexpectedly high female recombination rate near the centromere. Also, the level of recombination activity across the centromere of chromosome 21 is unknown.

Exploring centromeric female recombination activity for chromosome 21 relative to other acrocentric chromosomes might also be relevant for better understanding of the molecular basis of segregation errors resulting in trisomy 21. Indeed, the best documented molecular correlate of meiotic chromosomal non-disjunction (NDJ) is an abnormal frequency and distribution of recombination events between the two non-disjoined chromosomes (reviewed in 15,16). Half of NDJ events with the two 21q homologues transmitted during the first meiotic division present no detectable exchange between the two chromosomes. In contrast, those involving two 21q sister chromatids—so called MII events—are associated with a large excess of juxtacentromeric recombination events (17,18). The level of confidence in determining whether an NDJ event occurred in MI or MII depends on the genetic distance between the centromere and the most proximal genetic marker used (19). In most recent studies, the proximal microsatellite marker used is located 1.3 Mb away from the alphoid centromeric block (17). Consequently, the relative importance of absence of recombination versus centromeric recombination in non-disjunction could be overestimated. However, alphoid polymorphism analysis of non-disjoined chromosome captured individually in hybrid cells failed to reveal any 21q proximal exchange among 10 informative trisomy events (20). Therefore, if they exist, the undetected recombination events must occur within the very proximal 21q region, within the centromeric region itself or along the short arm of the chromosome.

A second molecular correlate with meiotic non-disjunction of chromosome 21 is the size of the alpha-satellite repeat array. Alpha-satellite, the major type of human centromeric tandem repeat, is present at all human centromeres and is variable in size between homologs for most chromosome pairs (2124). An association between small alphoid size of chromosome 21 and maternal non-disjunction has been reported in two independent studies, with different methods for size estimation of the chromosome 21 alpha-satellite I blocks (25,26). On another hand, satellite sequences constitute an important part of centromeric heterochromatin and heterochromatic regions have long been recognized as a poor substrate for recombination regardless of their chromosomal location (27). As suggested by genetic mapping analysis of Drosophila X chromosomes with partial deletions of centromeric heterochromatin, the large blocks of satellite DNA may influence the centromere effect (28). Whether small alphoid size and altered recombination distribution are correlated with non-disjunction of human chromosome 21 in dependent mechanistic pathways—with the alphoid block influencing recombination distribution—remains to be investigated.

We report here the characterization of juxta-centromeric markers for chromosome 21, including a short arm microsatellite marker, and the first estimates of recombination activity in male and in female across and near the centromere for both correctly and incorrectly disjoined chromosome 21. We have also investigated whether the size of the alpha-satellite centromeric DNA influences juxta-centromeric recombination.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Extension of the 21p contig sequence using paralogous duplications
Homology search in the BAC end sequence database using the 281 kb 21p contig sequence reported previously (AL163201) (29) identified BAC insert 2503J9 (AF254982.1), the T7 end of which presents 100% identity with the telomeric end of the 21p contig. Sequence analysis of this BAC insert revealed that three contigs (nos 5, 14 and 16) out of its 16 unordered contigs (30 April 2000 version) contain unique, non-tandemly repeated DNA, the remaining contigs consisting of satellite 3 and alpha-satellite sequences. Homology search in the human sequence database using ends of each of these three ‘non-satellite’ contigs identified two BAC sequences (AC027723 and AL139386) assigned to chromosome 10 and chromosome 13 respectively, each of them overlapping with contigs 5 and 14 and with contigs 14 and 16 respectively, with more than 98% nucleotide identity (Fig. 1). This suggested both an order for these three contigs and a size for each sequence gap between them. PCR amplification of BAC 2503J9 DNA across the two predicted gaps followed by sequencing of the PCR products were then performed and confirmed these predictions. Finally, a 56 026 bp contig was assembled that includes 2.7 kb of sequence overlapping with the distal end of the previously reported 21p contig (99.7% nucleotide identity; see Materials and Methods) followed by 45.6 kb consisting of non-tandemly repeated DNA plus, towards the telomere, 7.6 kb of the satellite 3 block. An independent effort produced by others at the Institute of Molecular Biology of Iena, and aimed at completing the AF254982 sequence, very recently confirmed the order between contig 5 and contig 14 (Dr Platzer, personal communication).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Juxtacentromeric sequences of human chromosome 21. Proximal 21p contig sequences AL163201 and 21q contig sequences AL163202 are shown on each side of the centromeric alpha-satellite I block (stripped box interrupted, CEN). Thirteen microsatellite elements among which 11 have a known location (vertical ticks) have been chosen all along the region for developing polymorphic markers. Sequence AF254982 of BAC insert 2503J9 extends the 21p contig towards the telomere, up to the satellite 3 block (dotted box) and the alpha-satellite II blocks (stripped boxes). Its proximal end shows 99.7% identity over a 2.7 kb overlap with the distal end of contig AL163201. The upper box magnifies the proximal end of sequence AF254982. This end comprises three contigs which have been assembled in silico using highly homologous paralogous sequences AC027723 and AL139386. This organization was confirmed experimentally by PCR amplification across the putative gaps (arrows) and sequencing of the resulting products.

 
Microsatellite markers in chromosome 21 juxta-centromeric sequences
Fifteen microsatellite elements were analysed, including 11 short tandem repeats (STRs) retrieved from the most proximal sequences of 21q (250 kb scanned) and 21p (326.6 kb), two microsatellites detected within a 41 kb 21p BAC insert not mapped precisely yet (BAC B1L1C6; A. DeSario, personal communication) and two proximal 21q microsatellite markers described elsewhere (30,31). In silico homology search using the BLAST tool (32) in human sequence databases together with PCR amplification data using DNAs of a monochromosomal hybrid cell line panel showed that none of these 15 elements is found exclusively as a unique copy within the juxtacentromeric region of chromosome 21 (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Microsatellite elements within the juxtacentromeric region of chromosome 21 and their paralogous copies
 
Paralogous copies of D21S215 (30) and of D21S369 (31) have been found in databases within sequences assigned to chromosomes 13, 18 and 10 (Table 1). Experimental data confirm that they are present on chromosome 10, 18 and 21 but not on chromosome 13, strongly suggesting incorrect chromosome assignation for this sequence in the database. D21S215 is therefore contained in an interchromosomal duplication but also in an intrachromosomal tandem duplication as it is present in several copies on each of chromosome 21 (two copies), chromosome 18 (two copies) and chromosome 10 (four copies). For the remaining 13 other STRs, ~600 bp of sequence flanking, on one side, paralogous copies of each STR were obtained by sequencing the PCR products amplified from monochromosomal DNAs. Multiple alignment between sequences produced experimentally plus those available in the sequence databases revealed a high level of nucleotide identity between paralogous copies, often close to allelic levels (less than 1/500 base substitutional difference between pairs of sequences). For the six most proximal 21p microsatellites plus one unassigned 21p microsatellite (B1L1C6.CA) there was no flanking base present only on chromosome 21. Visual inspection of electropherograms of PCR products amplified from chromosome 21, 13 and 15 revealed several double peaks scattered along the sequence, indicating that at least two distinct but highly similar copies were present on each of these chromosomes for the seven microsatellites. Furthermore, the same nucleotidic differences found between these intra-chromosomal copies were observed for the three different acrocentric chromosomes and fewer sequence variations were found between inter-chromosomal copies. This suggests that duplication occurred first within a chromosome short arm, before the recent (or ongoing) inter-chromosomal spreading of each copy.

Only in the six remaining cases was a base at a variant site in the flanking sequence specific for the 21 juxta-centromeric copy. These were used to detect the microsatellite either by designing PCR primers specific for the variant nucleotide at their 3' end or by restriction analysis following PCR, the variant base creating a restriction polymorphism between paralogous copies (Fig. 2). In three cases out of six, the unique STR detected was polymorphic between unrelated individuals. A highly polymorphic CA dinucleotide repeat (2503J9.TG), with 80% heterozygosity and 12 alleles among CEPH parents, was located 800 bp proximal from the satellite 3 block in 21p10 (BAC insert 2503J9). An imperfect CYTT tetranucleotide repeat (f92b11.tetra) and a TA dinucleotide repeat (f92b11.TA) located 550 bp away from each other, in 21q11.1, at 214 kb from the centromeric alphoid block (within clone f92b11) (29) presented respectively two and three alleles among CEPH parents. Analysis of inheritance of alleles of f92b11.TA and of 2503J9.TG microsatellite showed that one of the two alleles was not detected for two and four individuals, respectively, among 57 unrelated grand-parents. Moreover, the paralogous specific base used for the detection of 2503J9.TG, that had been detected by sequencing monochromosomal hybrid cell DNA of chromosome 21, was not present in the sequence available in database and assigned to chromosome 21 (AF254982; Fig. 2). These two observations suggest that the nucleotidic variation which allows discrimination of chromosome 21 juxtacentromeric microsatellite from other paralogous copies in the two cases was not present on all chromosomes 21, being an allelic variant base as well as a paralogous variant base.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Alignments between flanking sequences of microsatellite elements found in chromosome 21 juxta-centromeric regions and their paralogous copies. Chromosomal assignment of each sequence is given with its GenBank accession number when available. Other sequences were obtained by direct sequencing of PCR products amplified from DNA of monochromosomal hybrid cell lines (NA prefix). Only sequences of primer binding sites and of restriction sites (underlined) used for the specific detection of the chromosome 21 juxta-centromeric copy of each microsatellite are shown with their nucleotidic coordinate in the 21 juxta-centromeric GenBank sequence. Only nucleotide variants relative to the chromosome 21 target sequence are shown for paralogous copies. (A) A tetranucleotide microsatellite repeat present in 21q11 (f92b11.Tet) is detected after BclI restriction digest of the PCR product amplified with primer f92b11.Tetra F (left site) and primer f92b11.Tetra E (right site). (B) The TA dinucleotide repeat f92b11.TA is discriminated from paralogous copies by RsaI cleavage of PCR product amplified with primer f92b11.TAnD (left site) and primer f92b11.TAnE (right site). (C) The 21p10 copy of dinucleotide repeat 2503J9.TG is specifically amplified with the copy-specific primer 2503J9.TGX (left site) and primer 2503J9.TG5 (right site).

 
Recombination rates across and near the centromere of chromosome 21
Estimates of recombination rates per physical unit across and near the centromere (Fig. 3) were obtained from CRIMAP analyses of segregation data in 40 CEPH reference families of the two juxtacentromeric markers f92B11.TA and 2503J9.TG plus 22 other 21q markers, up to 6.6 Mb (6597 kb) away from the alphoid block (D21S1905). The location of these markers along the sequence map of chromosome 21 (29) was precisely determined from BLAST homology analyses. Using the CHROMPIC function of CRIMAP, 71 female and 10 male recombination events could be mapped in this region, within intervals as small as 44 kb (D21S409–D21S364). As no recombination event was detected between the three most proximal 21q11 loci (f92b11-TA, D21S369 and D21S215), these were considered together as a megalocus. As none of the uninformative families for these three markers was informative for f92b11-tetra, this marker was not used for segregation analyses. In the males, no recombination event among 146 double informative meioses was found between this 21q11 megalocus and the 21p10 locus (2503J9.TG), an interval spanning 2.3 Mb on average (see below for size estimation of alphoid blocks). Two crossovers among 298 informative male meioses were found in the proximal 2 Mb region, between this most proximal megalocus and a set of four loci clustered within 59 kb (D21S192, D21S1231, D21S415, D21S1234; only D21S192 is presented in Fig. 3 out of these four). Eight crossovers among 236 male informative events were found in the distal 3.7 Mb interval (D21S1234–D21S11). These figures indicate a strong repression of recombination across and also at distance from the centromere in male. In the females, one recombination event was found among 153 double informative meioses within the alphoid-centromeric interval delineated by the 21p10 marker and the 21q11 most proximal megalocus. Twenty-six crossovers among 273 informative meioses could be mapped unambiguously within the most proximal 2 Mb region, including nine crossovers within the region proximal to D21S408, and 41 crossovers among 255 informative meioses were found within the distal 3.8 Mb interval (D21S1231–D21S1905). The markers considered arbitrarily for delineating these two intervals were not informative in the three remaining cases. Therefore, the repressive effect upon recombination across the centromere was also observed in the females, with an ~10-fold reduction of recombination activity (0.23 cM/Mb) compared with chromosome average (12,13). However, in contrast to the male, this repressive effect was restricted to the centromeric interval in the females, the most proximal interval of 21q11, at 389 kb away from the alphoid centromeric block, showing a 4.3 cM/Mb recombination rate. A female-specific recombinationally hyperactive region lay within a 359 kb interval (D21S1256–D21S406), at 5 Mb away from the centromeric alphoid block. Within this interval, a maximum recombination rate occurred at over 12 cM/Mb within the 44 kb interval D21S409–D21S364 [reported in Lynn et al. (13) as 1.2 cM/44 kb].



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Recombination activity in the juxtacentromeric region of chromosome 21 in CEPH reference families. Recombination rate per physical unit (cM/Mb) in female (black dots, solid line) and in male (white dots, dashed line) have been deduced from segregation data of 24 markers delineating intervals of known physical size, up to 6.6 Mb away from the alphoid centromeric block (hatched box).

 
Inter-individual variations in recombination events distribution and in size of alpha-satellite block
Some mothers among the seven largest CEPH families present more recombination events within the proximal 6.6 Mb 21q region than others, extremes being family 884 with no female recombination event in the region among five children having inherited a recombinant chromosome and family 1331 showing five maternal recombination events in this region among seven recombinant children. This observation is reminiscent of inter-individual variations observed in the overall frequency of recombination in female (10,12) and it also suggests that the distribution of juxtacentromeric recombination varies between women. We hypothesized that the size of the alphoid DNA could influence in cis the extent of repression of recombination near 21cen. The size of the alpha-satellite blocks of chromosome 21 was therefore estimated by quantitative FISH (Q-FISH) using both alpha-satellite I probe {alpha}RI-680 and a non-repeated YAC DNA probe, located in 21q22, as an internal standard (25). Relationship between the intensity of a FISH signal and the actual physical size of the corresponding alpha-satellite block was deduced from pilot Q-FISH experiments with four chromosome 21 (one individual plus two monochromosomal hybrids) for which alphoid size had been estimated previously by Pulse Field Gel Electrophoresis and Southern blot analyses (23 and data not shown). Alpha-satellite type I block of chromosome 21 varied considerably in size between individuals, from less than 100 kb to 5.3 Mb (1.8 Mb on average) among 32 chromosome 21 (Fig. 4A), including those of the parents of the seven largest CEPH families. However, we found no strong relationship between distribution of recombination events in the pericentromeric region and size or combined size of the alphoid block of the two recombining chromosome 21 for seven CEPH mothers (Fig. 4B).




View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. Size of the alpha-satellite block and juxtacentromeric recombination. (A) Size distribution of centromeric alpha-satellite tandem array of chromosome 21. The size of the centromeric alpha-satellite type I array was estimated by quantitative FISH analysis for 32 chromosome 21, including 28 chromosomes 21 of parents from seven large CEPH families and two chromosomes 21 from two monochromosomal hybrid cell lines. Array size varies extensively and a third of all alphoid blocks are smaller than one megabase. (B) Juxtacentromeric meiotic breakpoints (crosses) and size of alphoid arrays (in Mb) of chromosome 21 from seven CEPH mothers. Each recombination breakpoint is represented as a cross in the middle of the interval (plain segment) in which it is located. Number and distribution of meiotic breakpoints observed among progeny varies between mothers.

 
Juxtacentromeric recombination and non-disjunction
To further examine the characteristics of recombination on chromosome 21 non-disjunction, 67 father–mother–trisomic child trios for which no recombination event had been detected previously along the two non-disjoined maternal 21q homologues (17) were typed with the juxtacentromeric markers. The hypothesis that we explored was that these errors were not related to the lack of recombination, but instead to a centromeric recombinant event that had not been identified using only pericentromeric markers on 21q.

The mother was heterozygous for the 21p10 marker in each of 26 trios (Table 2). In three cases, the mother, the father and the child shared the same two bands and therefore they were uninformative. Overall, 23 trios were thus informative for the 21p10 marker. In two of the 23 informative cases, the father showed one band, the mother was heterozygous and her child showed only the two maternal alleles that were of the same intensity. Given the results from the CEPH families presented above, the likely explanation for these two cases is that the father transmitted a null allele to the trisomic child.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the genotype results of the two most proximal centromeric markers among the trios in which there was a non-disjunctional error of maternal origin
 
Ten trios were informative for the 21q11 proximal marker, f92b11.TA, among which five were already informative with the 21p10 maker. All 10 cases, including seven cases solved by dosage analysis and three cases for which the three alleles of the trisomic child were distinct, showed transmission of the two maternal alleles.

Therefore, none of the non-disjoined chromosomes that were informative for at least one of the two juxtacentromeric markers show a recombination event within the newly explored centromeric region (23 cases) or within the most proximal juxtacentromeric interval (five additional cases). These results support the original hypothesis that the non-disjunctional error in this subset of cases was associated with the lack of recombination, not undetected centromeric recombination.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have characterised unique microsatellite markers embedded within the highly duplicated sequences found on both sides of the alpha-satellite centromeric block of chromosome 21. To achieve this, we extended 21p sequence contig and developed an approach derived from ARMS-PCR (33) and based on the use of paralogous specific variant bases (PSVs) (34) for the specific detection of the copy of the microsatellite elements found in chromosome 21 juxtacentromeric region.

Segregation analysis of these polymorphic genetic markers in reference families shows a strong repression of recombination across the centromere in male and confirms and refines previous observations (13) of a long-distance centromere effect in male. Female recombination is also repressed across the centromere, ~10-fold compared with chromosome 21 average. However, in contrast to male, recombination is not suppressed in the most proximal region of the q arm in female and it is even 20-fold higher than in the centromeric interval. A recombinationally hyperactive female-specific region has also been localized at 5 Mb away from the centromere between D21S409 and D21S364. This high level of recombination activity was already noticeable in a previous study (13), but adding segregation data of other nearby markers confirmed this observation and refined the localization of this hot region. Further refinement of the genetic map in this short interval might help fine-scale characterization of the first female recombination hot-spot(s) in human.

The mechanistic basis of non-disjunction of chromosome 21, leading to Down syndrome, is poorly understood. The two known molecular correlates with segregation errors of chromosome 21 are altered recombination and size of the centromeric alphoid block. Two independent studies have suggested that prevalence of small alphoid blocks is higher among mothers with a trisomic child than among correctly disjoined chromosomes 21 (25,26). Our study, which represents the first attempt to examine whether these two different observations share a common mechanism, suggests that the two effects are independent of each other. Size of the alpha-satellite block does not have a major effect on frequency of pericentromeric recombination. Segregation errors involving alphoid size could be more closely related to the centromere function itself than to the repression of recombination that the centromere exerts in its vicinity. Such an hypothesis has been tested previously and no relationship could be found between centromeric alphoid size of human chromosome Y and frequency of disomy in sperm (35). However, as it seems that non-disjunction results from the sum of various phenomena, each having a minor influence in the final outcome, only studies involving a much larger number of families (without and with trisomy 21 children) could rule out subtle relationships between these phenomena.

We show here that none of 28 informative non-disjoined chromosome 21 previously typed as nullitransitional homo-logs (i.e. without detectable crossover event) present a recombination event across the centromeric region or in most proximal sequences. This strengthens previous analysis of such 21q nullitransitional MI non-disjoined chromosomes captured individually in hybrid cells that indicated that proximal recombination in 21q is infrequent in trisomy-generating meioses (20). However, the discrepancies observed between meiotic stage determination based on proximal 21q markers and those based on 21p chromosome heteromorphisms (36,37) must still be considered. These could be attributed to recombination along short arm sequences located distally from the 21p10 marker described here, at least 340 kb distal from the alphoid centromeric block. Recent analysis of crossover distribution along chromosome 21 in Down syndrome patients presenting a (14q21q) robertsonian translocation suggests that this illegitimate exchange between short arms interferes with the location of crossover between long arms (38). In turn and as shown for free trisomy 21 events (17), these distal exchanges between long arms would increase the probability of a segregation error. Legitimate recombination activity along the short arm of chromosome 21 therefore remains to be investigated. In addition, the relationship between alphoid sequences and non-disjunction associated with detectable pericentromeric recombination described previously (17,18) needs to be further investigated.

The approach for characterizing chromosome-specific polymorphic markers embedded within duplication-rich regions should open the route to recombination analysis across most human centromeres and also within short arms of acrocentric chromosomes. However, only three markers were developed in this study out of 13 microsatellite elements tested because it was not possible, for most microsatellites, to find one variant base not shared with any other paralogous copies and close enough to the tandem repeat to be useful. This was due both to an extremely high nucleotide identity between copies, often above 99%, and also to the high number of inter- and intra- chromosomal paralogous copies. The extension of the contig sequence of chromosome 21p reported here relies on a 2772 bp overlap with five base substitutions between the distal end of the existing contig and the new clone sequenced. Although this figure is consistent with estimates of nucleotide diversity for chromosome 21 (39,40), the extremely high level of identity between non-homologous chromosomes in these regions makes it still possible that this clone originates from another chromosome. It could also originate from a paralogous duplication on chromosome 21p, on the distal side of the satellite 3 block. This would reconcile the discrepancy between the distribution of satellite blocks on the short arm suggested by the present analysis (cen>satellite 3>alpha II>tel) and the one reported previously (41). In this latter case, the microsatellite typed here and embedded in this clone would be located less than 400 kb further distal from the centromeric alphoid block, a figure that would not substantially change the overall picture of repressed recombination activity across the region. A better physical characterization of the short arm of all acrocentric chromosomes could respond to this uncertainity as the high probability of physical mapping errors in these regions originates in part from the fact that very few of the paralogous copies are properly mapped. Further, in-depth analysis of the level of nucleotide identity between and along short arm sequences of acrocentric chromosomes should allow the characterization of new specific polymorphic markers and should also provide hints concerning the mechanisms underlying exchanges between non-homologous chromosomes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Extension of the 21p contig sequence
The TIGR BAC end sequence database (www.tigr.org/tdb/humgen/bac_end_search.html) was screened with sequence AL163201. The T7 end of BAC insert 2503J9 was detected, showing 100% identity over 553 overlapping bases with the telomeric end of the contig. The BAC insert was sequenced in the genome sequencing center of the Institute of Molecular Biotechnology in Jena (Germany). Size estimates of the whole BAC insert and of the satellite blocks that it contains were deduced from pulse-field gel electrophoresis and Southern blot analyses and were consistent with the figures given by sequence analysis (data not shown).

Using the BLAST tool, the T7 end of the sequenced BAC 2503J9 (AF254982.1) showed 16 mismatches over 2772 overlapping bases with the 21p contig sequence AL163201, including three mismatches within polyA tracts. Eleven mismatches including these latter three plus eight base substitutions were found grouped within a 421 base-long region. Re-sequencing of this short region amplified from DNA of BAC 2503J9 using PCR primers 2503J9-olpB8.F (5' GACATGAATGAAAGCCCAGT 3') and primers 2503J9-olpB8.R (5' GGTCTGCACACTTGCAATGC 3') showed that four mismatches out of these eight base substitutions were sequencing errors and were, instead, identical to the corresponding AL163201 bases. Recent re-sequencing of the whole region in the Genome Sequencing laboratory of Iena confirmed that these four mismatches plus four others outside the 421 bp region were errors. The level of nucleotide identity between AL163201 and AF254982 over the overlap is therefore 99.8% (five base substitutions/2772 bp), excluding short tandem repeat polymorphisms.

Detection of juxtacentromeric microsatellite elements
Microsatellite elements were sought in silico in the 250 kb most proximal sequences of 21q, in the 326.6 kb chromosome 21p sequence and in 21p sequence AL049849 (BAC B1L1C6) with the Tandem Repeat Finder program (42) (http://tandem.biomath.mssm.edu/trf.html). Mononucleotide repeats and microsatellite elements containing less than 10 perfect repeats or flanked with dispersed repeats on each side were not considered further for analysis. The BLAST tool (32) was used to screen non-redundant (nr) and unfinished (htgs) human genomic sequence databases with the flanking sequences of the selected microsatellite elements in order to detect sequence of paralogous copies. The ClustalW multialignment program (43) was used to detect variant bases between flanking sequences of these paralogous copies.

For dinucleotide repeat 2503J9.TG, the 5' end of primer 2503J9.TG5 (5' GGATCAATGCCCACTCCATGTC 3') was radioactively labelled with P33 using polynucleotide kinase. The microsatellite was then amplified from ~100 ng genomic DNA, using 0.4 µM of this labelled primer, 0.4 µM of the copy-specific primer 2503J9.TGX (5' AACAGCTTGATGAACGGGT 3') and one unit of Taq DNA polymerase (Promega) in a buffer described previously (44) and in 20 µl volume. Cycling conditions in a Hybaid PCR express thermocycler were: 94°C, 1 min followed by 30 cycles at 94°C, 20 s, 66°C, 20 s and 72°C, 1 min. Dinucleotide repeat f92b11.TA was amplified using the labelled primer f92b11.TanE (5' GACCCTGACTTCCTGATTTG 3') and primer f92b11.TanD (5' TTCTGTCCACCCTTCACAAG 3') in the same conditions except for annealing temperature (58°C). Following amplification, f92b11.TA PCR product was ethanol-precipitated, washed, resuspended in 5 µl water and subjected to 2 h RsaI digest (1 unit). In the two cases, the products were subsequently subjected to electrophoresis in a 35 cm long denaturing (urea 7 M) 5% polyacrylamide gel (acrylamide :  bisacrylamide 39 : 1) and the gel was dried and exposed to an autoradiography film.

Tetranucleotide repeat f92b11.Tet was similarly amplified with unlabelled primers f92b11.TetE (5' GCAAAGTATTTGCTTATTGACTG 3') and f92b11.TetF (5' GAAGCTTCCAAACATGGCG 3') at 58°C annealing temperature followed by BclI restriction of the PCR product. Restriction digest products were then subjected to electrophoresis in a 4.5% non-denaturing 20 cm long polyacrylamide gel which was subsequently stained in ethidium bromide solution.


    ACKNOWLEDGEMENTS
 
We thank C. de Toma and H. Cann for the cell lines of CEPH parents, Y. Usson for valuable help on quantitative FISH image analysis, A. Rosenthal's laboratory for initial sequencing of BAC 2503J9, Matthias Platzer for help on merging its recent update of this sequence with ours and colleagues for useful discussion. This work was funded by the Fondation pour la Recherche Médicale, by the Association Française pour la Recherche sur la Trisomie 21 and by NIH R01 HD38979 (S.L.S.).


    FOOTNOTES
 
* To whom correspondence should be addressed at: Institut de Génétique Humaine, 141 rue de la Cardonille, 34396 Montpellier cedex 5, France. Tel: +33 499619977; Fax: +33 499619901; Email: jerome.buard{at}igh.cnrs.fr Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Choo, K.H.A. (1998) Why is the centromere so cold? Genome Res., 8, 81–82.[Free Full Text]

  2. Jackson, M.S., Gee See, C., Mulligan, L.M. and Lauffart, B.F. (1996) A 9.75-Mb map across the centromere of human chromosome 10. Genomics, 33, 258–270.[CrossRef][ISI][Medline]

  3. Nagaraja, R., MacMillan, S., Kere, J., Jones, C., Griffin, S., Schmatz, M., Terrell, J., Shomaker, M., Jermak, C., Hott, C. et al. (1997) X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content. Genome Res., 7, 210–222.[Abstract/Free Full Text]

  4. Mahtani, M.M. and Willard, H.F. (1998) Physical and genetic mapping of the human X chromosome centromere: repression of recombination. Genome Res., 8, 100–110.[Abstract/Free Full Text]

  5. Puechberty, J., Laurent, A.-M., Gimenez, S., Billault, A., Brun-Laurent, M.-E., Calenda, A., Marcais, B., Prades, C., Ioannou, P., Yurov, Y. et al. (1999) Genetic and physical analyses of the pericentromeric regions of human chromosomes 5 and 19. Recombination across 5cen. Genomics, 56, 274–287.[CrossRef][ISI][Medline]

  6. Mohrenweiser, H.W., Tsujimoto, S., Gordon, L. and Olsen, A.S. (1998) Regions of sex-specific hypo- and hyper-recombination identified through integration of 180 genetic markers into the metric physical map of human chromosome 19. Genomics, 47, 153–162.[CrossRef][ISI][Medline]

  7. Horvath, J.E., Bailey, J.A., Locke, D.P. and Eichler, E.E. (2001) Lessons from the human genome: transitions between euchromatin and heterochromatin. Hum. Mol. Genet., 10, 2215–2223.[Abstract/Free Full Text]

  8. Bailey, J.A., Yavor, A.M., Massa, H.F., Trask, B.J. and Eichler, E.E. (2001) Segmental duplications: organization and impact within the current human genome project assembly. Genome Res., 11, 1005–1017.[Abstract/Free Full Text]

  9. Bailey, J.A., Gu, Z., Clark, R.A., Reinert, K., Samonte, R.V., Schwartz, S., Adams, M.D., Myers, E.W., Li, P.W. and Eichler, E.E. (2002) Recent segmental duplications in the human genome. Science, 297, 1003–1007.[Abstract/Free Full Text]

  10. Broman, K.W., Murray, J.C., Sheffield, V.C., White, R.L. and Weber, J.L. (1998) Comprehensive human genetic maps: individual and sex-specific variation in recombination. Am. J. Hum. Genet., 63, 861–869.[CrossRef][ISI][Medline]

  11. Yu, A., Zhao, C., Fan, Y., Jang, W., Mungall, A.J., Deloukas, P., Olsen, A., Doggett, N.A., Ghebranious, N., Broman, K.W. et al. (2001) Comparison of human genetic and sequence-based physical maps. Nature, 409, 951–953.[CrossRef][Medline]

  12. Kong, A., Gudbjartsson, D.F., Sainz, J., Jonsdottir, G.M., Gudjonsson, S.A., Richardsson, B., Sigurdardottir, S., Barnard, J., Hallbeck, B., Masson, G. et al. (2002) A high-resolution recombination map of the human genome. Nat. Genet., 31, 241–247.[CrossRef][ISI][Medline]

  13. Lynn, A., Kashuk, C., Petersen, M.B., Bailey, J.A., Cox, D.R., Antonarakis, S.E. and Chakravarti, A. (2000) Patterns of meiotic recombination on the long arm of human chromosome 21. Genome Res., 10, 1319–1332.[Abstract/Free Full Text]

  14. van Hul, W., van Camp, G., Stuyver, L., Delabar, J.M., McInnis, M.G., Warren, A.C., Antonarakis, S.E. and van Broeckhoven, C. (1993) A contiguous physical map of the pericentromeric region of chromosome 21q between D21Z1 and D21S13E. Genomics, 15, 626–630.[CrossRef][ISI][Medline]

  15. Hassold, T., Sherman, S. and Hunt, P. (2000) Counting cross-overs: characterizing meiotic recombination in mammals. Hum. Mol. Genet., 9, 2409–2419.[Abstract/Free Full Text]

  16. Hassold, T. and Hunt, P. (2001) To err (meiotically) is human: the genesis of human aneuploidy. Nat. Rev. Genet., 2, 280–291.[CrossRef][ISI][Medline]

  17. Lamb, N.E., Feingold, E., Savage, A., Avramopoulos, D., Freeman, S., Gu, Y., Hallberg, A., Hersey, J., Karadima, G., Pettay, D. et al. (1997) Characterization of susceptible chiasma configurations that increase the risk for maternal nondisjunction of chromosome 21. Hum. Mol. Genet., 6, 1391–1399.[Abstract/Free Full Text]

  18. Lamb, N.E., Freeman, S.B., Savageaustin, A., Pettay, D., Taft, L., Hersey, J., Gu, Y.C., Shen, J., Saker, D., May, K.M. et al. (1996) Susceptible chiasmate configurations of chromosome 21 predispose to nondisjunction in both maternal meiosis-I and meiosis-II. Nat. Genet., 14, 400–405.[CrossRef][ISI][Medline]

  19. Antonarakis, S.E., Petersen, M.B., McInnis, M.G., Adelsberger, P.A., Schinzel, A.A., Binkert, F., Pangalos, C., Raoul, O., Slaugenhaupt, S.A., Hafez, M. et al. (1992) The meiotic stage of nondisjunction in trisomy 21: determination by using DNA polymorphisms. Am. J. Hum. Genet., 50, 544–550.[ISI][Medline]

  20. Shen, J.J., Sherman, S.L. and Hassold, T.J. (1998) Centromeric genotyping and direct analysis of nondisjunction in humans: Down syndrome. Chromosoma, 107, 166–172.[CrossRef][ISI][Medline]

  21. Wevrick, R. and Willard, H.F. (1989) Long-range organization of tandem arrays of alpha satellite DNA at the centromeres of human chromosomes: high-frequency array-length polymorphism and meiotic stability. Proc. Natl Acad. Sci. USA, 86, 9394–9398.[Abstract/Free Full Text]

  22. Mahtani, M.M. and Willard, H.F. (1990) Pulse-field gel analysis of alpha-satellite DNA at the human X chromosome centromere: high-frequency polymorphisms and array size estimate. Genomics, 7, 607–613.[CrossRef][ISI][Medline]

  23. Marcais, B., Bellis, M., Gerard, A., Pages, M., Boublik, Y. and Roizès, G. (1991) Structural organization and polymorphism of the alpha-satellite DNA sequences of chromosomes 13 and 21 as revealed by pulse field gel electrophoresis. Hum. Genet., 86, 311–316.[ISI][Medline]

  24. Jabs, E.W., Warren, A.C., Taylor, E.W., Colyer, C.R., Meyers, D.A. and Antonarakis, S.E. (1991) Alphoid DNA polymorphisms for chromosome 21 can be distinguished from those of chromosome 13 using probes homologous to both. Genomics, 9, 141–146.[CrossRef][ISI][Medline]

  25. Lo, A.W., Liao, G.C., Rocchi, M. and Choo, K.H. (1999) Extreme reduction of chromosome-specific alpha-satellite array is unusually common in human chromosome 21. Genome Res., 9, 895–908.[Abstract/Free Full Text]

  26. Maratou, K., Siddique, Y., Kessling, A.M. and Davies, G.E. (2000) Variation in alphoid DNA size and trisomy 21: a possible cause of nondisjunction. Hum. Genet., 106, 525–530.[CrossRef][ISI][Medline]

  27. Baker, W.K. (1958) Crossing over in heterochromatin. Am. Nat., 92, 59–60.[CrossRef]

  28. Yamamoto, M. and Miklos, G.L.G. (1978) Genetic studies on heterochromatin in Drosophila melanogaster and their implications for the functions of satellite DNA. Chromosoma, 66, 71–98.[CrossRef][ISI][Medline]

  29. Hattori, M., Fujiyama, A., Taylor, T.D., Watanabe, H., Yada, T., Park, H.S., Toyoda, A., Ishii, K., Totoki, Y., Choi, D.K. et al. (2000) The DNA sequence of human chromosome 21. Nature, 405, 311–319.[CrossRef][Medline]

  30. Warren, A.C., Petersen, M.B., van Hul, W., McInnis, M.G., van Broeckhoven, C., Cox, T.K., Chakravarti, A. and Antonarakis, S.E. (1992) D21S215 is a (GT)n polymorphic marker close to centromeric alphoid sequences on chromosome 21. Genomics, 13, 1365–1367.[CrossRef][ISI][Medline]

  31. Bosch, A., Nunes, V., Patterson, D. and Estivill, X. (1993) Isolation and characterization of 14 CA-repeat microsatellites from human chromosome 21. Genomics, 18, 151–155.[CrossRef][ISI][Medline]

  32. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res., 25, 3389–3402.[Abstract/Free Full Text]

  33. Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C. and Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucl. Acids Res., 17, 2503–2516.[Abstract/Free Full Text]

  34. Horvath, J.E., Schwartz, S. and Eichler, E.E. (2000) The mosaic structure of human pericentromeric DNA: a strategy for characterizing complex regions of the human genome. Genome Res., 10, 839–852.[Abstract/Free Full Text]

  35. Abruzzo, M.A., Griffin, D.K., Millie, E.A., Sheean, L.A. and Hassold, T.J. (1996) The effect of y-chromosome alpha-satellite array length on the rate of sex-chromosome disomy in human sperm. Hum. Genet., 97, 819–823.[ISI][Medline]

  36. Lorber, B.J., Grantham, M., Peters, J., Willard, H.F. and Hassold, T.J. (1992) Nondisjunction of chromosome 21: comparisons of cytogenetic and molecular studies of the meiotic stage and parent of origin. Am. J. Hum. Genet., 51, 1265–1276.[ISI][Medline]

  37. Petersen, M.B., Frantzen, M., Antonarakis, S.E., Warren, A.C., van Broeckhoven, C., Chakravarti, A., Cox, T.K., Lund, C., Olsen, B., Poulsen, H. et al. (1992) Comparative study of microsatellite and cytogenetic markers for detecting the origin of the nondisjoined chromosome 21 in Down syndrome. Am. J. Hum. Genet., 51, 516–525.[ISI][Medline]

  38. Berend, S.A., Page, S.L., Atkinson, W., McCaskill, C., Lamb, N.E., Sherman, S.L. and Shaffer, L.G. (2003) Obligate short-arm exchange in de novo Robertsonian translocation formation influences placement of crossovers in chromosome 21 nondisjunction. Am. J. Hum. Genet., 72, 488–495.[CrossRef][ISI][Medline]

  39. Patil, N., Berno, A.J., Hinds, D.A., Barrett, W.A., Doshi, J.M., Hacker, C.R., Kautzer, C.R., Lee, D.H., Marjoribanks, C., McDonough, D.P. et al. (2001) Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21. Science, 294, 1719–1723.[Abstract/Free Full Text]

  40. Sachidanandam, R., Weissman, D., Schmidt, S.C., Kakol, J.M., Stein, L.D., Marth, G., Sherry, S., Mullikin, J.C., Mortimore, B.J., Willey, D.L. et al. (2001) A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature, 409, 928–933.[CrossRef][Medline]

  41. Trowell, H.E., Nagy, A., Vissel, B. and Choo, K.H.A. (1993) Long-range analyses of the centromeric regions of human chromosomes 13, 14 and 21: identification of a narrow domain containing two key centromeric DNA elements. Hum. Mol. Genet., 2, 1639–1649.[Abstract/Free Full Text]

  42. Benson, G. (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucl. Acids Res., 27, 573–580.[Abstract/Free Full Text]

  43. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22, 4673–4680.[Abstract/Free Full Text]

  44. Jeffreys, A.J., Neumann, R. and Wilson, V. (1990) Repeat unit sequence variation in minisatellites: a novel source of DNA polymorphism for studying variation and mutation by single molecule analysis. Cell, 60, 473–485.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
F. Sun, M. Mikhaail-Philips, M. Oliver-Bonet, E. Ko, A. Rademaker, P. Turek, and R.H. Martin
Reduced meiotic recombination on the XY bivalent is correlated with an increased incidence of sex chromosome aneuploidy in men with non-obstructive azoospermia
Mol. Hum. Reprod., July 1, 2008; 14(7): 399 - 404.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
C. Grunau, J. Buard, M.-E. Brun, and A. De Sario
Mapping of the juxtacentromeric heterochromatin-euchromatin frontier of human chromosome 21
Genome Res., October 1, 2006; 16(10): 1198 - 1207.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
G. Roizes
Human centromeric alphoid domains are periodically homogenized so that they vary substantially between homologues. Mechanism and implications for centromere functioning.
Nucleic Acids Res., January 1, 2006; 34(6): 1912 - 1924.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
M.K. RUDD, M.G. SCHUELER, and H.F. WILLARD
Sequence Organization and Functional Annotation of Human Centromeres
Cold Spring Harb Symp Quant Biol, January 1, 2003; 68(0): 141 - 150.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/17/2229    most recent
ddg220v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Laurent, A.-M.
Right arrow Articles by Buard, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurent, A.-M.
Right arrow Articles by Buard, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?