Skip Navigation


Human Molecular Genetics Advance Access originally published online on September 30, 2004
Human Molecular Genetics 2004 13(23):2893-2906; doi:10.1093/hmg/ddh312
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/23/2893    most recent
ddh312v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kopra, O.
Right arrow Articles by Peltonen, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kopra, O.
Right arrow Articles by Peltonen, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 13, No. 23 © Oxford University Press 2004; all rights reserved

A mouse model for Finnish variant late infantile neuronal ceroid lipofuscinosis, CLN5, reveals neuropathology associated with early aging

Outi Kopra1,{dagger}, Jouni Vesa2,{dagger},{ddagger}, Carina von Schantz1, Tuula Manninen1,2, Helena Minye2, Anna-Liisa Fabritius2,, Juhani Rapola3, Otto P. van Diggelen4, Janna Saarela1, Anu Jalanko1 and Leena Peltonen1,2,*

1Department of Medical Genetics and Molecular Medicine, University of Helsinki and National Public Health Institute, Biomedicum Helsinki PL 104, FIN-00300 Helsinki, Finland, 2Department of Human Genetics, David Geffen School of Medicine at UCLA, Gonda Neuroscience and Genetics Research Center, Room 6506, Los Angeles, CA 90095, USA, 3Childrens hospital, University of Helsinki, Finland and 4Erasmus Medical Center, Department of Clinical Genetics, Rotterdam, The Netherlands

Received May 31, 2004; Accepted September 20, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Neuronal ceroid lipofuscinoses (NCL) comprise the most common group of childhood encephalopathies caused by mutations in eight genetic loci, CLN1–CLN8. Here, we have developed a novel mouse model for the human vLINCL (CLN5) by targeted deletion of exon 3 of the mouse Cln5 gene. The Cln5–/– mice showed loss of vision and accumulation of autofluorescent storage material in the central nervous system (CNS) and peripheral tissues without prominent brain atrophy. The ultrastructure of the storage material accurately replicated the abnormalities in human patients revealing mixture of lamellar profiles including fingerprint profiles as well as curvilinear and rectilinear bodies in electronmicroscopic analysis. Prominent loss of a subset of GABAergic interneurons in several brain areas was seen in the Cln5–/– mice. Transcript profiling of the brains of the Cln5–/– mice revealed altered expression in several genes involved in neurodegeneration, as well as in defense and immune response, typical of age-associated changes in the CNS. Downregulation of structural components of myelin was detected and this agrees well with the hypomyelination seen in the human vLINCL patients. In general, the progressive pathology of the Cln5–/– brain mimics the symptoms of the corresponding neurodegenerative disorder in man. Since the Cln5–/– mice do not exhibit significant brain atrophy, these mice could serve as models for studies on molecular processes associated with advanced aging.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Finnish variant late infantile neuronal ceroid lipofuscinosis (vLINCLFin, CLN5) is a member of neuronal ceroid lipofuscinoses (NCLs), the most common neurodegenerative disease group of childhood with a world-wide incidence of 1 : 12 500 (1). All the NCL disorders are characterized by similar clinical features with variable onset, and to date eight clinical subtypes have been described (CLN1–CLN8). The first symptoms of vLINCLFin start between 4 and 7 years of age with motor clumsiness that is followed by progressive visual failure resulting in blindness, as well as motor and mental deterioration. Later, disease progress is characterized by myoclonia and seizures with death occurring between 14 and 36 years of age. Autopsy reveals severe brain atrophy due to the dramatic destruction of cerebral and cerebellar neurons. Like in all the NCL disorders, accumulation of autofluorescent material is observed in both neural- and extra-neural tissues. The ultrastructure of the inclusion bodies exhibits a varied mixture of fingerprint profiles as well as curvilinear and rectilinear bodies (2). The main accumulating protein component of inclusions is subunit c of mitochondrial ATP synthase (3), typical of all the NCL subtypes except the most severe infantile form INCL/CLN1.

Positional cloning efforts resulted in the localization of the defective gene behind CLN5 to chromosome 13q22 (4) and subsequent identification of the mutated gene (5,6). The CLN5 gene consists of four exons encoding 407 amino acids and spans 13 kb of genomic DNA. The CLN5 polypeptide is glycosylated and targeted to lysosomes in non-neuronal cell lines and it most likely has both soluble and membrane-bound forms due to the usage of alternative initiation methionines (7,8). The longest form of CLN5 has been suggested to interact with two other NCL proteins, CLN2 and CLN3, representing a lysosomal enzyme tripeptidyl-peptidase I (TPPI) and a lysosomal membrane protein with unknown function, respectively. Further, the CLN2/TPPI activity has been shown to be elevated in fibroblasts of the vLINCLFin patients (8) implying that CLN5 and CLN2 are involved in the same pathological cascade resulting in different subtypes of NCLs.

Mouse models are available for CLN1 (9, Jalanko et al., manuscript in preparation), CLN3 (1012), CLN6 (nclf) (13) and CLN8 (mnd) (14,15), of which nclf and mnd mice represent naturally occurring disease mutations. Unlike many other mouse models for human disease, the reported CLN mice replicate relatively faithfully the cellular phenotype of their human counterparts.

We developed a mouse model for human vLINCLFin disease by interrupting the mouse Cln5 gene. The CLN5-deficient mice show deterioration of vision and accumulation of autofluorescent storage material in the central nervous system (CNS), kidney, liver and spleen. The ultrastructure of the storage material closely resembled that of the human patients showing both curvilinear and fingerprint profiles. Immunohistochemical analyses showed a selective loss of GABAergic neurons, and gene expression profiling revealed changes implying neuronal destruction, inflammation and defects in the components that affect myelin integrity.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cln5–/– mice show loss of vision
To generate a mouse model for human vLINCLFin disease, we interrupted the mouse Cln5 gene by eliminating exon 3 through insertion of the neor-cassette (Fig. 1A). The genotypes of all mice were determined by PCR over the insertion where the wild-type allele produced a 653 bp amplification product and the mutant allele a 394 bp amplification product (Fig. 1B). Sequence analysis of the RT–PCR products revealed that the deletion of exon 3 resulted in a frame shift and a premature stop codon in exon 4 of mouse Cln5 (Fig. 1C). Homozygous mutant mice were born at the expected Mendelian frequency, they developed without any obvious abnormalities and they were fertile. Progress of wild-type, heterozygous and homozygous mice were followed regularly from 5 weeks up to 8 months of age, and all changes in behavior, such as grooming, gait and general activity, were recorded. The body mass as well as the brain mass of each sacrificed mouse was also measured. No abnormal behavior was observed in the Cln5–/– mice when compared with the heterozygous or wild-type littermates. The Cln5–/– mice showed neither loss of body- nor brain masses (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Generation of the Cln5–/–. (A) Schematic drawing of the targeting strategy. Arrows show the location of the primers used in PCR genotyping. XhoI/EcoRI indicate the targeting site of the construct in pPNT-vector. (B) PCR analysis of mouse tail DNA to determine the genotypes of mice. Wild-type allele produces a 653 bp amplification product and mutant allele produces a 394 bp amplification product. (C) RT–PCR analysis of mRNA isolated from mouse brain. Wild-type allele produces a 805 bp product and mutant allele produces a 653 bp product. Genotypes are indicated above.

 
Progressive loss of vision is one of the first symptoms in human patients and therefore visual progression of the wild-type, heterozygous and homozygous mice were assessed by a forelimb extension test. This test is included in the SHIRPA protocol for phenotype assessment of a new mouse model as a primary test to assess visual placing (16). The Cln5–/– mice showed progressive impairment in the test beginning around the age of 13 weeks and severe loss of vision at the average age of 21 weeks (Fig. 2). Wild-type and heterozygous animals performed similarly in the test, showing no impairment during the test period from 5 to 37 weeks.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Progress of visual impairment. Progressive impairment of the homozygous animals in fore limb extension test indicates a progressive loss of vision by age. Ages of the animals are demonstrated in X-axis and recordings of the forelimb extension are on the Y-axis. 0, None; 1, upon nose contact; 2, upon vibrissa contact; 3, before vibrissa contact (18 mm); 4, early vigorous extension (25 mm).

 
Neuropathological assessments
Another characteristic neuropathological finding in all the NCL disorders is the massive accumulation of autofluorescent material in the CNS. We monitored accumulation of autofluorescent lipopigments in the CNS of the 1- and 6-month-old Cln5–/– mice as well as their wild-type siblings. Six-month-old Cln5–/– mice exhibited a prominent accumulation of autofluorescence throughout the brain (Fig. 3). In the cerebral cortex of the Cln5–/– mice, autofluorescent material was scattered throughout the cortical mantle, except for layer I (Fig. 3B). Increase of fluorescence in the cortical Cln5–/– neurons was statistically significant when compared with wild-type controls [124.87±41.77 (n=60) versus 60.55±25.18 (n=60), P<0.0001]. In the hippocampus, the most prominent autofluorescence signals were seen in the CA2 region (data not shown). Several nuclei in the midbrain also exhibited intense intracellular fluorescent inclusions (Fig. 3D). Elevated autofluorescence was found already in the 1-month-old Cln5–/– brains although distinctly less than in the older animals (Fig. 3F). The storage was not as obvious in the cerebellum. In the retina, the abnormal autofluorescence was localized merely in the ganglion cell layer, in the horizontal cells of the inner nuclear layer as well as in the photoreceptor cells of the outer nuclear layer (Fig. 3H).



View larger version (119K):
[in this window]
[in a new window]
 
Figure 3. Autofluorescence in the CNS. Six-month-old Cln5–/– mice show extensive accumulation of autofluorescent material throughout the brain, especially in the cerebral cortex (Ctx) (B) and several nuclei in the midbrain (MB) (D) when compared to with the wild-type control (A, C). Elevated autofluorescence is detected already in the brain of the 1-month-old Cln5–/– mouse (F) but not in the wild-type brain (E). In the retina of Cln5–/– mouse (G), abnormal autofluorescent storage is mainly found in the ganglion cell layer (gcl), the inner nuclear layer (inl) and the outer nuclear layer (onl). In the wild-type retina (G), only naturally occurring background autofluorescence is detected in the inner segment (is).

 
Electronmicroscope analyses of the storage material in the 3-month-old Cln5–/– brains revealed the presence of inclusion bodies in many neurons of the cerebral cortex and thalamus region. They contained a mixture of lamellar bodies, some showing also curvilinear pattern and fingerprint profiles (Fig. 4). Similar bodies are seen in the cells of human vLINCLFin patients (2). No obvious brain atrophy or other morphological abnormalities of the Cln5–/– brain were observed by hematoxylin and eosin staining by the age of 6 months (data not shown). This observation held true also for cerebellum, which in the vLINCLFin patient's brains shows the earliest and the most prominent atrophy (17).



View larger version (225K):
[in this window]
[in a new window]
 
Figure 4. Ultrastructure of the intracellular inclusion body in the cortical neuron of Cln5–/– mouse. Electronmicrograph reveals arrangement of the fingerprint-type lamella. Curvilinear bodies are not shown in the picture. Bar=200 nm.

 
Loss of GABAergic interneurons in the CNS of the Cln5–/– mice
Earlier studies of the NCL patients as well as the animal models have exhibited evidence for dysfunction of a subset of inhibitory neuron populations as well as hypertrophy of the persisting neurons (1823). To address the character of the degenerated cell type in Cln5–/– mice, we examined the immunoreactivity of calbindin and parvalbumin, markers for a subset of GABAergic interneurons, in the brain sections of the 1- and 6-month-old Cln5–/– animals as well as of age-matched controls. Six-month-old Cln5–/– mice showed a prominent loss of both calbindin and parvalbumin immunoreactive neurons in several brain areas including the cerebral cortex, hippocampus, thalamic nuclei, midbrain and cerebellum (Fig. 5). In the cerebral cortex, the loss of immunoreactivity against these interneuron populations was especially evident in the deeper cortical layers (Fig. 5B) and in the entorhinal cortex (Fig. 5D). In the cerebellum, loss of immunoreactivity in the Purkinje cell layer was also seen (Fig. 5F). Also, in the 1-month-old Cln5–/– mice, some reduction of calbindin and parvalbumin immunoreactivity was found in the cerebrum and the cerebellum as demonstrated in Figure 6.



View larger version (146K):
[in this window]
[in a new window]
 
Figure 5. Interneuron staining in the brains of 6-month-old mice. Immunostaining of calbindin positive GABAergic interneurons (indicated as brown color) reveal substantial loss of immunopositive profiles (arrows) in the cerebral cortex and the cerebellum of the 6-month-old Cln5–/– mouse (B, D, F) when compared with the age-matched control (A, C, E). Ctx, cerebral cortex; ECtx, entorhinal cortex; CB, cerebellum.

 


View larger version (136K):
[in this window]
[in a new window]
 
Figure 6. Interneuron staining in the brains of 1-month-old mice. Loss of calbindin immunopositivity (brown color; arrows) is evident already in the brain of the 1-month-old Cln5–/– mouse (B, D, F) when compared with the age-matched control brain (A, C, E).

 
Soluble and membrane-associated lysosomal enzyme activities in the Cln5–/– brain
Previous reports of the CLN5 patient fibroblasts (8) as well as the brain lysates of the CLN3 patients (24) have demonstrated elevated CLN2/TTP1 activity. Also, in the brains of the CLN3 patients, an overall increase in the activities of several other lysosomal enzymes has been reported. We determined the activities of Ppt1, Tpp1, ß-hexosaminidase, ß-galactosidase and ß-glucosidase in the cerebrums of the 1-, 8-, 15- and 30-day-old Cln5–/– and wild-type littermates. No systematic differences were observed in any of the enzyme activities, although Tpp1 activities were slightly elevated at day 15 in the Cln5–/– mice. Interestingly, all the measured enzyme activities showed a significant developmental regulation in the brain (Fig. 7).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 7. Lysosomal enzyme activities. No major difference in palmitoyl-protein thioesterase (Ppt1), tripeptidyl-peptidase (Tpp1), ß-hexosaminidase (B-Hex), ß-glucosidase (B-Gluc) or ß-galactosidase (B-Gal) is seen in homozygous animals when compared with normal controls, except slightly elevated Tpp1 activities at postnatal day 15. All enzyme activities are developmentally regulated from postnatal day 1 till 1 month of age.

 
Gene expression profiling
To obtain some understanding of the consequences of the global gene expression in the CNS, comparative gene expression profiling was performed in the brain tissues of the 3- and 4.5-month-old wild-type and Cln5–/– mice. To average out the inter-individual variability, we pooled RNA extracted from two wild-type and two Cln5–/– mouse cerebrums in both age groups. The integrity of each RNA was checked by monitoring for signs of degradation and S28/S18 ratio using Agilent 2100 Bioanalyzer (Agilent Technologies) prior to pooling. The global expression profiling was performed using Mouse genome U74Av2 arrays, containing majority of the known mouse genes, following manufacturer's instructions (Affymetrix, USA). The raw data were analyzed using the MAS 5.0 (Affymetrix) software. About 50% of the genes represented on the Murine Genome U74Av2 array were expressed in the brain tissue at a level detectable by the method, and only probe sets that attained a quality score ‘present’ (P<0.05) in two of the four hybridizations were accepted for further analyses. Since the number of experiments in this preliminary survey did not allow statistical comparison between the Cln5–/– and wild-type mice, a cut-off point of 2-fold was chosen on the basis of the collected replicate arrays of multiple mouse models in our array core (www.helsinki.fi/biochipcenter). The expression array data revealed changes of ≥2-fold for 16 genes in the cerebrums of the 3-month-old Cln5–/– mice. In the 4.5-month-old Cln5–/– mice, a total of 68 genes showed altered expression levels in cerebrums of ≥2-fold when compared with aged-matched controls cerebrums. Complete lists of the genes showing ≥2-fold change in the 3- and 4.5-month-old mice cerebrums are provided in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Genes regulated ≥2-fold in the Cln5–/– mice (3- and 4.5-month-old)
 
To obtain some insight into the biological processes associated with the observed transcriptional profiles, annotation information according to the publicly available gene ontology classification system (25) was collected for the 84 genes showing ≥2-fold change difference in transcript levels. As expected, most of the biological processes were represented by only a gene, but the identified classes pinpoint three major pathways or structural elements that were predominantly targeted in the Cln5–/– mice: inflammatory/defense mechanisms, myelin components and neuronal degeneration. Further analysis revealed several genes within these biological processes showing differences in expression levels between the Cln5–/– mice and their normal littermates, although not all of these changes reached the ≥2-fold cut-off level (Table 2). For the two age groups, the inflammatory pathway as well as components of myelin clearly came up.


View this table:
[in this window]
[in a new window]
 
Table 2. Pathway analysis of gene expression profiling
 
Quantitative real-time PCR analysis was performed for four selected genes (Gfap, Il-4, S3-12 and Mobp) that showed altered expression levels in the microarray data. Gfap showed up-regulation of 1.8-fold in the Cln5–/– cerebrums compared with the wild-type controls ({Delta}Ct –3.67 versus –2.86). No signal was detected for Il-4 in the wild-type control sample, whereas in Cln5–/– the {Delta}Ct value reached 12.34, demonstrating that the Il-4 mRNA level was distinctly up-regulated in the Cln5–/– brain. S3-12 was down-regulated by 1.4-fold in Cln5–/– ({Delta}Ct 3.19 versus 2.71). These data were in good agreement with the array results. In contrast, no change in transcript level of Mobp was detected in the Cln5–/– brains compared with controls ({Delta}Ct –5.68 versus –5.41).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The identification of the human NCL disease genes has enabled the production of mouse models for these severe neurodegenerative disorders. Here, we report a novel mouse model for the Finnish variant of LINCL disease, vLINCLFin. The generated mutation more closely resembles the Swedish mutation Glu253Stop, where an insertion of a cytosine causes a frame shift leading to 29 irrelevant amino acids before a premature stop codon, resulting in a truncated polypeptide of 253 amino acids (6). Four different CLN5 mutations are currently known, all of them having very different consequences for the predicted polypeptides. However, the clinical manifestations do not seem to vary depending on the mutations, and it is likely that all mutations severely disturb the yet unknown function of CLN5 (6). Thus, it is reasonable to assume that disruption of exon 3 of mouse Cln5 results in a non-functional protein.

The Cln5–/– mice developed normally and were fertile. No symptoms characteristic of INCLFin patients, such as progressive motor abnormalities or development of seizures, were detected in mice by the age of 8 months. Consistent with the loss of vision in human vLINCLFin patients, the Cln5–/– mice showed progressive impairment of forelimb extension that was used to initially test the deterioration of vision. Also, similar to human disease, the Cln5–/– mice had excessive accumulation of autofluorescent material in the CNS, and electronmicroscopical evaluation of the storage material showed mixture of lamellar profiles including fingerprint profiles and curvilinear bodies. Thus, the cellular findings mimic the pathology of cells in human vLINCLFin disease implying that the Cln5–/– mice develop a specific disorder that closely resembles vLINCLFin.

We have previously shown that CLN5 physically interacts with CLN2 (TPP1) and CLN3 in vitro as well as that TPP1 activity is elevated in vLINCLFin patient fibroblasts (8). The activities of five lysosomal enzymes, including Ppt1 and Tpp1, revealed no overall changes in the brains of the Cln5–/– mice except a slight increase in Tpp1 activity. Cln3 immunopositivity did not reveal any cross abnormality in the Cln5–/– brains compared with the wild-type controls (data not shown), nor the Cln3 or Cln2 mRNA expression profiles were altered in the microarray analyses. More detailed studies are needed in order to clarify the molecular mechanisms of interactions between different NCL proteins in vivo.

A mouse model for the most severe NCL disorder, INCL, exhibits NCL-like pathology including prominent accumulation of autofluorescent lipopigments throughout the CNS, pronounced cerebral atrophy, progressive motor abnormalities, spontaneous myoclonic seizures and a shortened lifespan (9). A very similar phenotype to this Cln1/Ppt1 mouse model has been demonstrated in the second Cln1–/– mouse (Ppt1{Delta}ex4, Jalanko et al., manuscript in preparation) with seizures, myoclonic jerks, paralysis of hind limbs and shortened life span. The Cln5–/– mice exhibit a remarkably milder phenotype in agreement with the milder clinical phenotype of vLINCLFin when compared with INCL.

The phenotypes of other mouse models for NCL diseases are affected by both the type of the mutation generated and the genetic background of the mice. Two Cln3 null mutant models have been produced by targeted disruption of the Cln3 gene (10,11). These mice show mild but systematic neuropathological abnormalities including accumulation of autofluorescent lipopigments that ultrastructurally resemble multilamellar rectilinear/fingerprint profiles. Inclusions contain subunit c of mitochondrial ATP synthase as in human disease. A third Cln3 mouse model has been produced by a knock-in strategy to replicate the ~1 kb deletion in the CLN3 gene representing the most common mutation of the CLN3 patients (12). Interestingly, these Cln3{Delta}ex7/8 mice develop earlier and more pronounced NCL-like symptoms than the null mutants, and show detectable pathological findings even prenatally. It is likely that the presence of the mutant Cln3 protein interferes with cellular homeostasis differently when compared with the situation where the protein is totally absent. Semi-quantitative RT–PCR from exon 4 of Cln5 revealed equal amount of mRNA in the brain tissue of the Cln5–/– and control mice (data not shown). However, currently available antibodies do not allow definitive conclusions of the presence of the mutant Cln5 protein in tissues of the Cln5–/– mice. Further, the current Cln5–/– mouse strain has a mixed genetic background (RW4/C57Bl/6), and inbreeding experiments in the future will show whether the genetic background has some impact on the disease phenotype.

The molecular pathway linking mutant proteins to the CNS phenotypes in different NCL diseases, characterized by accumulation of the storage material and neurodegeneration, remains a mystery. However, mouse models have provided some insight into the neuropathological mechanisms behind NCL. A prominent loss of some GABAergic interneurons in the brains of the generated Cln5–/– mice is an interesting finding and indicates a dysfunction of selected interneurons as a typical neuropathological hallmark of many, if not all, NCL-disorders. Other NCL mouse models have also been reported to exhibit progressive loss of a subpopulation of GABAergic interneurons in the cortex and hippocampus with persisting interneurons showing pronounced hypertrophy and abnormal dendritic morphology (23,24). On the other hand, it has been reported that changes in ionotropic glutamate receptors possibly alter glutamatergic neurotransmission in naturally occurring mouse model for NCL (26). Thus, the developed Cln5–/– mouse will now provide a new valuable tool to explore mechanisms of neuronal death in NCLs.

Gene expression profiling of the Cln5–/– mice revealed changes in the steady-state expression level for several genes that are involved in immune response, myelin integrity and neuronal degeneration. Activation of immunological defense mechanisms and defects of myelin were especially pinpointed. Several inflammation-associated genes showed up-regulation in the older mice (e.g. interleukin 16, beta-2 microglobulin, glial fibrillary acidic protein) when compared with the younger animals implying ongoing pathological processes in the brain and fitting well with the findings in vLINCLFin patients. Similar findings have also been reported for Cln1- and Cln3-deficient mice (27), as well as in the patients of two other lysosomal storage disorders, Tay–Sachs and Sandhoff diseases (28). In fact, inflammatory responses and activation of microglia contribute to most neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, multiple sclerosis and AIDS-associated dementia, as well as to ischemia and post-traumatic brain injury (2933). The initial events triggering the neurodegenerative processes in these various disorders are probably different, resulting in different neuropathological outcome. However, they most probably initiate a similar cascade of cytokine production in response to neuronal injury (34).

Several myelin-associated genes, such as myelin-associated oligodendrocytic basic protein (Mobp), myelin oligodendrocyte glycoprotein as well as myelin and lymphocyte protein, were down-regulated in the brains of the Cln5–/– mice already at 3 months of age. From this age on, also a progressive loss of vision was observed in the mutant animals. This finding is well in line with the pathological findings in the vLINCLFin patients including the loss of myelin sheath in the brain white matter as well as axonal loss both in the brain and in the retina. We could confirm the observed transcript differences in case of three genes out of four tested. Down-regulation of Mobp could not be confirmed by RT–PCR analysis. Characteristic for such comparisons, different location of PCR primers and the microarray probes is the most probable reason for this discrepancy. It should be emphasized that the array experiments are perhaps more valuable to monitor clustered information of transcript profiles of meaningful biological pathways, rather than transcript levels of individual genes. Subtle although coordinated changes in transcript levels can be monitored more readily by combining measurements over multiple members of each gene set (35). This is exemplified here with differences in expression levels of multiple genes related to neuronal degeneration and myelin destruction although not all of them at the significant level.

Transcript profiling of the aging brain in mice displays parallels with neurodegenerative disorders including inflammatory and stress responses (36). Also other features, such as atrophy of the selected neuron populations, synapse loss, decrease of certain receptor populations as well as accumulation of autofluorescent lipopigments, are shared with normal brain aging as well as with other lysosomal storage disease models and neurodegenerative disorders (37,38). Brain aging is associated with subtle morphological and functional alterations in specific neuronal circuits, as opposed to large-scale neuronal loss (36). Shared features with transcript profiles of the Cln5–/– mice revealing no significant brain atrophy suggest a role of the produced mouse model also in molecular studies of advanced aging.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ethical aspects
The study is approved by the Chancellor's Animal Research Committee at UCLA as well as by the animal care and use committees of the National Public Health Institute, Helsinki, Finland. The work has been carried out following the good practice in handling of laboratory animals and the regulations for handling genetically modified organisms.

Disruption of the mouse Cln5 gene and generation of the Cln5–/– mice
The targeting construct was designed to disrupt the exon 3 of mouse Cln5 gene. The 5' target of 2.8 kb (from the end of exon 1 to beginning of exon 3) and the 3' target of 2.6 kb (from the end of exon 3 through part of exon 4) were amplified from 129sv mouse DNA and ligated into the XhoI and EcoRI sites of pPNT-vector. The neomycin-resistant (neor) gene interrupts exon 3. The NotI linearized targeting construct was electroporated into the RW4 ES-cells which were maintained in ES-cell medium (Dulbecco's modified Eagle's medium with 15% ES-cell qualified fetal serum, leukemia inhibitory factor, glutamine, non-essential aminoacids, penicillin–streptomycin, ß-mercaptoethanol) on mitotically inactivated MEF feeder cells. ES-cells were selected in G418 (350 µg/ml) and ganciclovir (2 µM) for 10–14 days. Resistant colonies were picked, grown and DNA was isolated. Homologous recombination was identified by PCR analysis in which the other primer was in neomycin cassette and the other one in the exon 4 outside the target. Primer sequences for target amplification are as follows:

  • 5' Target Ex1F: TAATTCTCGAGCGCTGGCCGTGCCCTACAA–
  • Ex3R: TAATTCTCGAGCTCAATTGTGTAGTTCTTGCCTG
  • 3' Target Ex3F: TAATTGAATTCCACTGGAAGGAAAACGGGACA–
  • Ex4R: AGTCTTGTTTCCTTTGGGCCC

Positive colonies were injected into the C57Bl/6 blastocysts followed by transfer into pseudopregnant recipient Swiss Webster females. Two ES-cell lines produced chimeras that showed germline transmission as indicated by coat color. Following, breeding was done to the C57Bl/6 strain. F1 offspring were genotyped and heterozygous animals were inbred to generate Cln5–/– homozygous mice.

Genotyping and RT–PCR
Genomic DNA was prepared from the ear punch samples using DNeasy Tissue Kit (Qiagen, Valencia). An aliquot of 10 ng of DNA was amplified using following primers:

  • Intr2F: GTGTCCTTACACAGCTCACATGTGTGCTGAAT
  • Intr3R: GAGCCTCGCAATTCCTAGCAAGGCTCTACATC
  • Neo5: 5'-CTTGTGTAGCGCCAAGTGCC-3'

For RT–PCR analysis of the wild-type, heterozygous and mutant mice, total RNA was isolated with RNeasy kit (Qiagen, Valencia) following the manufacturer's guidelines. The reverse transcription reaction was carried out using Cln5-specific primer 5'-GTCGGTAAATGTTGTATGTCG-3' followed by PCR reactions with following primers: 5'-CACTGGCCGGTGCCCTACAA-3'; 5'–CTGTCTGTGTATAATCACTGTAT-3'. Produced DNA fragments of 805 bp (wild-type) and 653 bp (Cln5–/–) were analyzed by agarose gel electrophoresis. The nucleotide sequence of RT–PCR products of both wild-type and mutant mice were determined to confirm the frame shift due to partial deletion of the Cln5 gene of mutant mice.

Evaluation of the phenotype
Progress of 18 wild-type, 19 heterozygous and 22 homozygous mice was followed three times a week for 5 min from 5 weeks to 8 months in order to detect changes in gait, grooming and other behaviors. After sacrificing, brain and body weight was determined.

The forelimb extension test (16) was used to assess the progression of vision since progressive loss of vision is one of the first symptoms in human patients. In the test, the mice were lowered by base of the tail from a height of ~15 cm above the wire grid. Extension of forelimbs was recorded as follows: 0, none; 1, upon nose contact; 2, upon vibrissa contact; 3, before vibrissa contact (18 mm) and 4, early vigorous extension (25 mm).

Histological and immunohistochemical studies
For immunohistochemical studies of the 1- and 6-month-old wild-type, homozygous and heterozygous mice were sacrificed and brain, liver, kidney and spleen were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS), pH 7.4, over night and embedded in paraffin. The tissue samples were cut into 5 µm sections and stained with hematoxylin and eosin using a standard protocol for basic morphological evaluations. Immunohistochemical stainings of the brains were done with parvalbumin-specific antibodies (PV, Swant, Bellinzona; 1 : 6000) and calbindin-specific antibodies (Cb, Swant; 1 : 5000), goat-antirabbit secondary serum (1 : 250) and avidin–biotin peroxidase method (ABC-Elite, Vector) using the previously published protocol (39). The results were analyzed by light microscopy (Olympus). Autofluorescence was evaluated from brain sections that were rehydrated in xylene and decreased alcohol series followed by immediate dehydration. The coverslips were mounted with DePex and the sections were studied by fluorescence microscope (Olympus). Average pixel intensity in the cell soma of 60 cortical Cln5–/– neurons and 60 wild-type neurons was measured by Leica cofocal microscope (Leica) and the quantify mode of the Leica TCS software. Images of cells were acquired using the same laser beam intensity and photodetector sensitivity to allow quantitative comparison of relative fluorescence intensity of cells between groups. Difference between groups was analyzed with Student's t-test. The level of significance was P<0.05.

Electronmicroscopy
Brain samples were excised from sacrificed mice, and sliced into 2 mm tissue blocks. Tissue samples were then fixed in 2.5% glutaraldehyde/0.05 M PBS, pH 7.2 for 3 h and stored in 0.05 M PBS until processed further. Small pieces were osmicated, dehydrated and embedded in the epoxy resin using standard method. Ultra thin sections were contrasted with uranyl acetate and lead citrate. The sections were analyzed and photographed by a transmission electronmicroscope.

Measurements of soluble and membrane-associated lysosomal enzyme activities
Cerebrums from the 1-, 8-, 15- and 30-day-old Cln5–/– (n=4) and wild-type (n=4) mice were collected, frozen in liquid nitrogen and subjected to enzyme activity assays. Palmitoyl-protein thioesterase 1, Tpp1, ß-hexosaminidase, ß-galactosidase and ß-glucosidase activity assays were performed as previously reported by van Diggelen et al. (40).

Gene expression profiling
Comparative gene expression profiling was performed in the 3- and 4.5-month-old mice. Cerebrums from two wild-type controls and homozygous Cln5 mice per age group were frozen in liquid nitrogen, pooled and homogenized. Total RNA was extracted using Qiagen RNeasy-kit following manufacturer's instructions. The quality of RNA was assessed by Agilent 2100 Bioanalyzer (Agilent Technologies), monitoring for S28/S18 ratio and signs for degradation. An aliquot of 5 µg of total high-quality RNA from each sample was used to generate cDNA containing an initiation site for T7 RNA polymerase (Super Choice system, Gibco-BRL). Double-stranded cDNA was purified by Gene Chip Sample Cleanup Module (Affymetrix) and 1 µg of cDNA was subjected to an in vitro transcription reaction using biotinylated UTP and CTP (Enzo Bioarray High Yield RNA Transcript Labeling Kit). Biotinylated cRNA was purified using RNeasy mini-kit (Qiagen). An aliquot of 20 µg of biotinylated cRNA was fragmented in 1x fragmentation buffer (40 mM Tris–acetate, pH 8.1, 100 mM KOAc, 30 mM MgOAc) at 94°C for 35 min, of which 1 µl was subjected to an analysis on 1% agarose gel, after which 15 µg was hybridized on to each array.

Gene expression profiles of wild-type and mutant mice were analyzed using the Affymetrix Murine Genome U74Av2 high-density oligonucleotide array representing all Mouse UniGene database sequences (approximately 6000) that have been functionally characterized as well as approximately 6000 EST clusters. Hybridization, post-hybridization washes, staining and array scanning were performed in the Affymetrix GeneChip System following the manufacturer's instructions.

The primary data analysis was performed using GeneChip Microarray Analysis suite version 5, MAS 5.0 (Affymetrix, Santa Clara). Before analysis, the data were normalized via global scaling (target intensity=100). Probe arrays were verified for absence of anomalies in the data registered for the spiked control probes, the cross-species hybridization control probes and the housekeeping probe controls. All probe sets that attained a quality score ‘absent’ in all four hybridizations were removed from further analysis. A difference of 2-fold was applied to select up-regulated and down-regulated genes. Pathways were identified by utilizing the UCSC Mouse Genome Browser Gateway, Oct 2003 freeze (http://genome.ucsc.edu/) and the NCI Cancer Genome Anatomy Project (http://cgap.nci.nih.gov/Pathways).

Real-time RT–PCR
For the gene expression measurements, the total RNA were isolated from the samples using Qiagen RNeasy-kit following manufacturer's instructions. cDNA was prepared using Applied Biosystems TaqMan cDNA transcription kit according to manufacturer's protocol. Elimination of the genomic DNA was done by additional DNAse treatment before the cDNA synthesis. An aliquot of 200 ng of total RNA was treated with DNAse I (Roche Diagnostics, Germany). Random hexamers (Applied Biosystems, California) were used to prime the first-strand synthesis and the reaction was carried out in a total volume of 20 µl with Multiscribe Reverse transcriptase enzyme according to manufacturer's protocol (Applied Biosystems, California). A total of 1.8 µl of cDNA was used for each TaqMan measurement triplicate.

Predesigned and tested fluorogenic FAM–labeled assays-on-demand primers/probes were used to measure transcription levels of the selected genes (Il-4, Gafp, S3-12, Mobp). Real-time RT–PCR was carried out according to manufacturer's protocols using TaqMan Universal PCR master mix (Applied Biosystems, California). ABI Prism 7700 sequence detector instrumentation was used for signal detection. Sequence detector was programed to an initial step of 2 min at 50°C and 10 min at 95°C, followed by 50 thermal cycles of 15 s at 95°C and 1 min at 60°C.

Calculations
The quantitative value obtained from the TaqMan run is a threshold cycle Ct, which indicates the number of PCR cycles at which the amount of amplified target molecule exceeds a predefined threshold value (41). The difference value ({Delta}Ct), in turn, is the normalized quantitative value of the expression level of the target gene. Normalization is achieved by subtracting the Ct value of the TATAbox-binding protein (TBP), a general transcription factor, from the Ct value of the target gene. Expression for normalization is expressed as {Delta}Ct=Ct(target) – Ct(TBP).

Change of one unit in the {Delta}Ct value indicates a 2-fold change in the relative expression level of the gene. Since the PCR efficiency for both the endogenous control (TBP) and target gene assays is tested by the manufacturer and proven to be very close to 100%, the comparative method can be used to compare fold differences between different samples. Comparative calculations determine the difference in {Delta}Ct between Cln5–/– and Cln5+/+ samples. Signal intensity threshold was set to the beginning of the log linear range of amplification plot being 0.05. The absolute change in expression level is given by 2{Delta}{Delta}Ct.


    ACKNOWLEDGEMENTS
 
We are grateful to Ms Anne Nyberg for excellent technical help and Mr Sami Mustala for helping with the figures. We also wish to thank Dr Jarno Honkanen for RT–PCR analyses. Dr Jussi Naukkarinen is acknowledged for revising the language. This work was supported by The Academy of Finland, Centre of Excellence Grant 44870, Life 2000 Grant 72628, the Sigrid Juselius Foundation, the Batten Disease Support and Research association and the Wihuri Foundation. Leena Peltonen is a Gordon and Virginia Mac Donald Distinguished Chair in Human Genetics, David Geffen School of medicine at UCLA.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Department of Molecular Medicine, National Public Health Institute, Biomedicum Helsinki PL 104, FIN-00251 Helsinki, Finland. Tel: +358 947448393; Fax: +358 947448480; Email: leena.peltonen{at}ktl.fi

{dagger} The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Back

{ddagger} Present address: Cedars-Sinai Medical Center, Davis Building, Department of Pediatrics and David Geffen School of Medicine at UCLA, Los Angeles, CA, USA. Back

Present address: Department of Applied Biology, University of Helsinki, Finland. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Hofmann, S.L. and Peltonen, L. (2001) The neuronal ceroid lipofuscinoses. In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Base of Inherited Disease. McGraw-Hill Companies Inc., USA, Vol. 3, pp. 3877–3894.

  2. Santavuori, P., Rapola, J., Haltia, M., Tyynelä, J., Peltonen, L. and Mole, S. (1999) CLN5. Finnish variant late infantile NCL. In Goebel, H.H., Mole, S.E. and Lake, B.D. (eds), The Neuronal Ceroid Lipofuscinoses (Batten Disease). IOS Press, Amsterdam, Vol. 33, pp. 91–97.

  3. Tyynelä, J., Suopanki, J., Santavuori, P., Baumann, M. and Haltia, M. (1997) Variant late infantile neuronal ceroid-lipofuscinosis: pathology and biochemistry. J. Neuropathol. Exp. Neurol., 56, 369–375.[ISI][Medline]

  4. Savukoski, M., Kestilä, M., Williams, R., Järvelä, I., Sharp, J., Harris, J., Santavuori, P., Gardiner, M. and Peltonen, L. (1994) Defined chromosomal assignment of CLN5 demonstrates that at least four genetic loci are involved in the pathogenesis of human ceroid lipofuscinoses. Am. J. Hum. Genet., 55, 695–701.[ISI][Medline]

  5. Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E.S. and Peltonen, L. (1998) CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet., 19, 286–288.[CrossRef][ISI][Medline]

  6. Holmberg, V., Lauronen, L., Autti, T., Santavuori, P., Savukoski, M., Uvebrant, P., Hofmann, I., Peltonen, L. and Järvelä, I. (2000) Phenotype–genotype correlation in eight patients with Finnish variant late infantile NCL (CLN5). Neurology, 22, 579–581.

  7. Isosomppi, J., Vesa, J., Jalanko, A. and Peltonen, L. (2002) Lysosomal localization of the neuronal ceroid lipofuscinosis CLN5 protein. Hum. Mol. Genet., 15, 885–891.

  8. Vesa, J., Chin, M.H., Oelgeschlager, K., Isosomppi, J., DellAngelica, E.C., Jalanko, A. and Peltonen, L. (2002) Neuronal ceroid lipofuscinoses are connected at molecular level: interaction of CLN5 protein with CLN2 and CLN3. Mol. Biol. Cell., 13, 2410–2420.[Abstract/Free Full Text]

  9. Gupta, P., Soyombo, A.A., Atashband, A., Wisniewski, K.E., Shelton, J.M., Richardson, J.A., Hammer, R.E. and Hofmann, S.L. (2001) Disruption of PPT1 or PPT2 causes neuronal ceroid lipofuscinosis in knockout mice. Proc. Natl Acad. Sci. USA, 98, 13566–13571.[Abstract/Free Full Text]

  10. Mitchison, H.M., Bernard, D.J., Greene, N.D., Cooper, J.D., Junaid, M.A., Pullarkat, R.K., de Vos, N., Breuning, M.H., Owens, J.W., Mobley, W.C. et al. (1999) Targeted disruption of the Cln3 gene provides a mouse model for Batten disease. The Batten Mouse Model Consortium [corrected]. Neurobiol. Dis., 6, 321–334.[CrossRef][ISI][Medline]

  11. Katz, M.L., Shibuya, H., Liu, P.C., Gao, C.L. and Johnson, G.S. (1999) A mouse gene knockout model for juvenile ceroid-lipofuscinosis (Batten disease). J. Neurosci. Res., 57, 551–556.[CrossRef][ISI][Medline]

  12. Cotman, S.L., Vrbanac, V., Lebel, L.A., Lee, R.L., Johnson, K.A., Donahue, L.R., Teed, A.M., Antonellis, K., Bronson, R.T., Lerner, T.J. et al. (2002) Cln3(Deltaex7/8) knock-in mice with the common JNCL mutation exhibit progressive neurologic disease that begins before birth. Hum. Mol. Genet., 11, 2709–2721.[Abstract/Free Full Text]

  13. Bronson, R.T., Donahue, L.R., Johnson, K.R., Tanner, A., Lane, P.W. and Faust, J.R. (1998) Neuronal ceroid lipofuscinosis (nclf), a new disorder of the mouse linked to chromosome 9. Am. J. Med. Genet., 77, 289–297.[CrossRef][ISI][Medline]

  14. Bronson, R.T., Lake, B.D., Cook, S., Taylor, S. and Davidson, M.T. (1993) Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten's disease). Ann. Neurol., 33, 381–385.[CrossRef][ISI][Medline]

  15. Messer, A. and Plummer, J. (1993) Accumulating autofluorescent material as a marker for early changes in the spinal cord of the Mnd mouse. Neuromuscul. Disord., 3, 129–134.[CrossRef][Medline]

  16. Rogers, D.C., Fisher, E.M.C., Brown, S.D.M., Peters, J., Hunter, A.J. and Martin, J.E. (1997) Behavioral and functional analysis of mouse phenotype: SHIRPA, a proposed protocol for comprehensive phenotype assessment. Mamm. Genome, 8, 711–713.[CrossRef][ISI][Medline]

  17. Autti, T., Raininko, R., Launes, J., Nuutila, A. and Santavuori, P. (1992) Jansky–Bielschowsky variant disease: CT, MRI, and SPECT findings. Pediatr. Neurol., 8, 121–126.[CrossRef][ISI][Medline]

  18. Williams, R.S., Lott, I.T., Ferrante, R.J. and Caviness, V.S. (1977) The cellular pathology of neuronal ceroid lipofuscinosis. Arch. Neurol., 34, 298–305.[Abstract]

  19. Braak, H. and Goebel H.H. (1978) Loss of pigment-laden stellate cells: a severe alteration of the isocortex in juvenile neuronal ceroid lipofuscinosis. Acta Neuropathol. (Berl.), 42, 53–57.[CrossRef][Medline]

  20. Braak, H. and Goebel, H.H. (1979) Pigmentoarchitectonic pathology of the isocortex in juvenile neuronal ceroid lipofuscinosis: axonal enlargements in layer IIIab and cell loss in layer V. Acta Neuropathol. (Berl.), 46, 79–83.[CrossRef][Medline]

  21. Bertamini, M., Marzani, B., Guarneri, R., Guarneri, P., Bigini, P., Mennini, T. and Curti, D. (2002) Mitochondrial oxidative metabolism in motor neuron degeneration (mnd) mouse central nervous system. Eur. J. Neurosci., 16, 2291–2296.[CrossRef][ISI][Medline]

  22. March, P.A., Wurzelmann, S. and Walkley, S.U. (1995) Morphological alterations in neocortical and cerebellar GABAergic neurons in a canine model of juvenile Batten disease. Am. J. Med. Genet., 57, 204–212.[CrossRef][ISI][Medline]

  23. Cooper, J.D., Messer, A., Feng, A.K., Chua-Couzens, J. and Mobley, W.C. (1999) Apparent loss and hypertrophy of interneurons in a mouse model of neuronal ceroid lipofuscinosis: evidence for partial response to insulin-like growth factor-1 treatment. J. Neurosci., 19, 2556–2567.[Abstract/Free Full Text]

  24. Cooper, J.D. (2003) Progress towards understanding the neurobiology of Batten disease or neuronal ceroid lipofuscinosis. Curr. Opin. Neurol., 16, 121–128.[CrossRef][ISI][Medline]

  25. The Gene Ontology Consortium (2000) Gene ontology: tool for the unification of biology. Nature Genet., 25, 25–29.[CrossRef][ISI][Medline]

  26. Mennini, T., Bigini, P., Ravizza, T., Vezzani, A., Calvaresi, N., Tortarolo, M. and Bendotti, C. (2002) Expression of glutamate receptor subtypes in the spinal cord of control and mnd mice, a model of motor neuron disorder. J. Neurosci. Res., 15, 553–560.[CrossRef]

  27. Elshatory, Y., Brooks, A.I., Chattopadhyay, S., Curran, T.M., Gupta, P., Ramalingam, V., Hofmann, S.L. and Pearce, D.A. (2003) Early changes in gene expression in two models of Batten disease. FEBS Lett., 13, 207–212.

  28. Myerowitz, R., Lawson, D., Mizukami, H., Mi, Y., Tifft, C.J. and Proia, R.L. (2002) Molecular pathophysiology in Tay–Sachs and Sandhoff diseases as revealed by gene expression profiling. Hum. Mol. Genet., 15, 1343–1350.

  29. Aisen, P.S. (2002) Anti-inflammatory agents in Alzheimer's disease. Curr. Neurol. Neurosci. Rep., 2, 405–409.[Medline]

  30. Beal, M.F. (2003) Mitochondria, oxidative damage, and inflammation in Parkinson's disease. Ann. NY Acad. Sci., 991, 120–131.[CrossRef][ISI][Medline]

  31. Carson, M.J. (2002) Microglia as liaisons between the immune and central nervous systems: functional implications for multiple sclerosis. Glia, 40, 218–231.[CrossRef][ISI][Medline]

  32. Saha, R.N. and Pahan, K. (2003) Tumor necrosis factor-alpha at the crossroads of neuronal life and death during HIV-associated dementia. J. Neurochem., 86, 1057–1071.[CrossRef][ISI][Medline]

  33. Becker, K.J. (1998) Inflammation and acute stroke. Curr. Opin. Neurol., 11, 45–49.[CrossRef][ISI][Medline]

  34. Tarkowski, E. (2002) Cytokines in dementias. Curr. Drug Targets Inflamm. Allergy, 1, 193–200.[CrossRef][Medline]

  35. Mootha, V.K., Lindgren, C.M., Eriksson, K.-F., Subramanian, A., Sihag, S., Lehar, J., Puigserver, P., Carlsson, E., Ridderstråle, M., Laurila, E. et al. (2003) PGC-1{alpha}-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat. Genet., 34, 267–273.[CrossRef][ISI][Medline]

  36. Lee, C.-K., Weindruch, R. and Prolla, T. (2000) Gene-expression profile of the ageing brain in mice. Nat. Genet., 25, 294–297.[CrossRef][ISI][Medline]

  37. Wada, R., Tifft, C.J. and Proia, R.L. (2000) Microglial activation precedes acute neurodegeneration in Sandhoff disease and is suppressed by bone marrow transplantation. PNAS, 26, 10954–10959.

  38. Finch, C.E. and Roth, G.S. (1999) In Seigel, G., Agranoff, J.B., Albers, W.R.W., Fisher, S.K. and Uhler, M.D. (eds), Basic Neurochemistry. Lippincott-Raven, Philadelphia, pp. 613–633.

  39. Heinonen, O., Kyttälä, A., Lehmus, E., Paunio, T., Peltonen, L. and Jalanko, A. (2000) Expression of palmitoyl protein thioesterase in neurons. Mol. Gen. Metab., 69, 123–129.[CrossRef][ISI][Medline]

  40. van Diggelen, O.P., Keulemans, J.L.M., Kleijer, W.J., Thobois, S., Tilikete, C. and Voznyi, Y.V. (2001) Pre- an postnatal enzyme analysis for infantile, late infantile and adult neuronal ceroid lipofuscinosis (CLN1 and CLN2). Eur. J. Pediatr. Neurol., 5, 189–192.

  41. Hämäläinen, H.K., Tubman, J.C., Vikman, S., Kyrölä, T., Ylikoski, E., Warrington, J.A. and Lahesmaa, R. (2001) Identification and validation of endogenous reference genes for expression profiling of T helper cell differentiation by quantitative real time RT–PCR. Anal. Biochem., 299, 63–70.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
J.-W. Chang, H. Choi, H.-J. Kim, D.-G. Jo, Y.-J. Jeon, J.-Y. Noh, W. J. Park, and Y.-K. Jung
Neuronal vulnerability of CLN3 deletion to calcium-induced cytotoxicity is mediated by calsenilin
Hum. Mol. Genet., February 1, 2007; 16(3): 317 - 326.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Pears, J. D. Cooper, H. M. Mitchison, R. J. Mortishire-Smith, D. A. Pearce, and J. L. Griffin
High Resolution 1H NMR-based Metabolomics Indicates a Neurotransmitter Cycling Deficit in Cerebral Tissue from a Mouse Model of Batten Disease
J. Biol. Chem., December 30, 2005; 280(52): 42508 - 42514.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/23/2893    most recent
ddh312v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrow