Transgenic mice carrying an Xist -containing YACEdith Heard1,*, Chantal Kress2, Fabien Mongelard3, Béatrice Courtier1, Claire Rougeulle1, Alan Ashworth4, Claire Vourc'h3, Charles Babinet2 and Philip Avner1
1Unité de Génétique Moléculaire Murine and 2Unité de Génétique de Mammifères, Institut Pasteur, 25 rue du Docteur Roux, F-75724 Paris Cedex 15, France, 3Equipe Dyogen, Institut Albert Bonniot, Faculté de Médecine, 38706 La Tronche Cedex, France and 4CRC Center for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK
Received November 17, 1995;Revised and Accepted January 16, 1996
The initiation of X-chromosome inactivation in female mammals is controlled by a key locus, the X-inactivation centre (Xic). The Xist gene, which maps to the candidate region for Xic and is expressed exclusively from the inactive X chromosome, is thought to be an essential component of the Xic. To test whether sequences spanning several hundred kilobases and including Xist from the Xic region are capable of initiating inactivation, we have created a series of transgenic mice using a 460 kb yeast artificial chromosome (YAC). Analysis in these mice of the expression of Xist, of a LacZ reporter gene and of two genes in the region that are normally silent on the inactive X chromosome, suggests that essential sequences for Xist expression and X-inactivation may be absent in these transgenic animals.
Mammalian X-chromosome inactivation is the process by which one of the two X chromosomes in female somatic cells is transcriptionally silenced, resulting in dosage compensation for X-linked gene products between males and females (1 ). Evidence that a unique site on the X chromosome, the X-inactivation centre (Xic), is required to initiate inactivation in cis which then spreads along the length of the X chromosome (~150 Mb), comes from studies of chromosomal rearrangements, such as translocations in which the X chromosome is divided and only one of the two resulting segments is able to undergo inactivation (2 ,3 ).
Based on studies of such abnormal X chromosomes in man and mouse, the candidate region for the Xic has been progressively narrowed down and currently spans 680-1200 kb within band Xq13 in man (4 ). The murine Xic region, located in the distal part of band XD, is much less well defined, although the overall conservation of the order of markers in this part of the X chromosome allows extrapolation of the more detailed mapping available in the human to the mouse (5 ). In the mouse a further locus, known as the X chromosome-controlling element (Xce), has been mapped genetically to a similar part of the X chromosome as the Xic (6 ). The Xce locus appears to affect the random nature of X-inactivation such that in females heterozygous for different alleles of Xce, one X chromosome is more likely to be inactivated than the other (7 ). The position of Xce and its apparent influence on the X-inactivation process have led to suggestions that Xic and Xce may be synonymous.
The Xist gene, which lies within the Xic region in man and mouse, has the unique property of being expressed exclusively from the inactive X chromosome (Xi) (8 -10 ). Expression of Xist is tightly correlated with the presence of an inactive X chromosome, not only in adult somatic cells but also in the testis, the only male organ in which X-inactivation has been described (11 ,12 ). Recent data suggests, however, that Xist expression in somatic cells may not actually be required for maintenance of the inactive state (13 ,14 ). Overall, the evidence supports a role for Xist in the initiation of X-inactivation (15 ,16 ) and the recent generation of a targeted deletion of the Xist gene has confirmed its importance in effecting the onset of X-inactivation (17 ). The Xist transcript appears to be non-coding in both man and mouse. This has led to speculation that it may act as a functional RNA (18 ) or, alternatively, that the active transcription of the region containing Xist may be important for X-inactivation by causing a conformational change in the chromatin that would then spread to the rest of the X chromosome, resulting in X-inactivation (19 ). As might be expected for a gene involved in the initiation of X-inactivation, Xist expression in cis precedes X-inactivation during early mouse development (15 ). However, the actual onset of Xist transcription at the 4-cell stage (16 ) precedes the onset of overt X-inactivation in the trophectoderm of blastocysts by 1-2 days. This suggests that Xist expression may not in itself be sufficient to effect X-inactivation and that other factors may be required.
Most theories concerning the initiation of X-inactivation evoke the need for a mechanism that senses the number of X chromosomes in a cell, such that only a single X chromosome remains active for every two sets of autosomes. The Xic is most probably involved in this `counting' mechanism which might be mediated by a `blocking' signal that is produced in limited quantity and binds to the Xic of a single X chromosome per diploid cell, protecting it from inactivation. Some form of developmental cue is also necessary, triggering the inactivation process which then spreads along the length of the X chromosome (20 ). The initiation of X-inactivation thus seems likely to involve complex interactions between multiple factors.
In addition to Xist, two new genes, Cdx4 (21 ) and Bpx(22 ) as well as an element (DXPas34) whose methylation status correlates with the Xce allele carried by the active X chromosome (23 ), have recently been identified in the Xic region, lying distal and 3' to Xist. Furthermore, genetic mapping of the Xce locus with informative microsatellite markers flanking Xist has shown that although Xce and Xist are tightly linked, they are separable genetic loci with Xce probably lying 3' and telomeric to Xist (24 ). The possibility that other sequences in the Xic region, in addition to Xist, may have a role in X-inactivation must therefore be considered. One could imagine that the Xic might be constituted of a number of diverse genetic elements (including Xist and Xce), that are distributed across a region of the X chromosome and must act in concert in order for X-inactivation to be successfully initiated.
We have set out to test whether a 460 kb region, which includes the Xist gene as well as two genes that are normally silent on the inactive X chromosome (Cdx4 and Bpx), is capable of initiating the X-inactivation process in vivo, away from its normal chromosomal context. A yeast artificial chromosome (YAC) covering this region was used to generate transgenic mice via pronuclear microinjection. None of the four animals carrying Xist showed significant expression of the transgene. In one line, in which the YAC was integrated as a single intact copy, expression was found from both the Cdx4 and Bpx transgenes as well as from a LacZ reporter gene linked to the YAC, implying that the transgenic region was indeed in an `active' rather than an `inactive' state. These data suggest that essential sequences for X-inactivation and Xist expression are lacking in these transgenic animals and that the chromosomal domain necessary to bring about successful X-inactivation in a different chromosomal context is not intact.
The 460 kb YAC (PA-2) (25 ) used in this studycontains sequences 130 kb 5' and 310 kb 3' to the Xist gene and includes the recently characterised Cdx4 (21 ) and Bpx (22 )genes, that are located ~100 and 300 kb 3' to Xist respectively (see Fig. 1 ). The YAC was modified by homologous recombination in yeast to introduce a LacZ reporter gene into the left vector arm as a visual marker for inactivation.
As the aim of our study was to determine whether the YAC PA-2 insert is capable of X-inactivation in a transgenic context, it was important for the interpretation of the functional analysis of lines 53 and 80 to assess, as far as possible, the structural integrity of the transgenic sequences by pulsed field gel electrophoresis (PFGE). The availability of a detailed map of the X-chromosome region in which YAC PA-2 lies (25 ) facilitated the analysis of a murine YAC on a murine background. The enzymes and probes used and the deduced structures of the two transgenes are shown in Figure 3 a. Restriction fragments internal to the YAC insert in line 53 were shown to be intact, as exemplified by the 220 kb Xist-containing BssHII fragment detected by probes b and c (Fig. 3 b) and the 200 kb DXPas19-containing SalI fragment detected by probe d (data not shown). Linkage and absence of rearrangements of the YAC sequences was also demonstrated by the co-localisation of probes on single large fragments generated by enzymes that cut rarely within the YAC insert. For example, in line 53 probes a, b, c and d detect a common 300 kb EagI fragment, and probes e, f and g detect common 200 and 450 kb EagI fragments (the latter being a partial digestion product). All of the probes in line 53 detect a common NotI fragment of ~2 Mb (Fig. 3 c). While such data indicated the integrity of the YAC in line 53, a partial duplication of the region adjacent to the insertion point of the left YAC arm was revealed by additional NotI bands detected by probes close to this end of the YAC (probes e, f and g). The duplication appears to be inverted and to span ~100 kb, as illustrated in Figure 3 a (data not shown).
The expression of Xist from an X chromosome in somatic cells is thought to reflect the inactive status of that chromosome. Normal XY males thus exhibit negligible levels of Xist expression. We investigated Xist expression in F1 males of lines 53 and 80 and in non-transgenic littermates, using reverse-transcription (RT) PCR analysis. No Xist transcripts were detected in line 53 males, whilst very low and tissue-variable levels of Xist expression were found in line 80 (Fig. 4 a). Two male founders, 15 and 55 (non-transmitting, see Table 1 ), that carry a Xist transgene were also tested and similarly revealed very low or negligible levels of Xist expression (data not shown). Semi-quantitative RT-PCR and PhosphorImager analysis on line 80 males demonstrated that the highest levels of Xist expression, seen in liver cells, correspond to only 1% of endogenous Xist expression in females. Similar levels were found in founder animal 15. To determine the origin of such expression, SSCP analysis was performed (Fig. 4 b). This permits transcripts derived from the YAC (C3H/He) to be distinguished from transcripts derived from an endogenous Xist gene of SJL origin (see Materials and Methods). Expression in line 80 males and the founder male 15 was found to be derived almost exclusively from the Xist transgene, not the endogenous gene. Such low, tissue-variable, Xist transgene expression may be the result of illegitimate transcription or position effects acting on the truncated YAC fragments in lines 80 and 15. SSCP was also used to assess Xist transgene expression in females, where endogenous Xist transcripts are present at high levels. No transgenic expression was detectable in F1 females of line 53 and only slight expression was seen in females of line 80, consistent with the results obtained for line 80 males (Fig. 4 b). Finally, animals homozygous for the line 53 transgene were assessed for transgenic Xist expression but none was detected (Fig. 4 a). Males homozygous for the line 80 transgene showed a 2-fold increase in the low levels of Xist expression over hemizygotes (data not shown).
The expression of two other genes within the YAC, Cdx4 and Bpx, was investigated in line 53. Cdx4 is expressed in the liver of adult mice at low levels (21 ), and Bpx is highly expressed in the brain (22 ). Both of these genes are normally subject to X-inactivation in female cells and their transcriptional status on the YAC transgene could therefore provide an indication of the active or inactive status of the transgenic region.
In order to enable distinction of transgenic and endogenous Cdx4 and Bpx transcripts, the line 53 transgene was bred into animals whose X chromosomes are derived from a congenic mouse strain (129.Pgk1a) (23 ) for which the relevant part of the X chromosome is of Mus musculus musculus (PGK) origin and is thus highly polymorphic with respect to the Mus musculus domesticus (C3H/He) derived YAC. An informative polymorphism in the 3' untranslated region of the Cdx4 gene was identified by sequencing of the alleles derived from the C3H/He and 129.Pgk1a strains. Adult liver RNA from transgenic and control animals was examined for Cdx4 expression by SSCP analysis of the cDNA product (see Fig. 5 ). Expression of the transgenic Cdx4 cDNA allele was detected together with the endogenous allele in the liver of line 53 animals. The absence of transgene expression in brain, a tissue in which Cdx4 is not normally expressed (data not shown), demonstrated the specificity of the transgene expression.
In the case of Bpx, a M.musculus domesticus/M.musculus musculus sequence polymorphism in the 3'UTR of the gene (22 ) permitted RT-SSCP analysis of transgene expression. As in the case of Cdx4, Bpx transgene expression was detected in the appropriate tissue (brain) of line 53 animals (Fig. 5 ) but not in tissues, such as liver and testis, where Bpx is not normally expressed.
Both Cdx4 and Bpx are thus correctly expressed from the YAC transgene in line 53. As these genes are subject to X-inactivation on the X chromosome, their active status as transgenes in line 53 suggests that the YAC PA-2 transgenic region is not undergoing inactivation in these animals.
To investigate whether YAC PA-2 could inactivate a linked LacZ reporter gene, driven by a cytomegalovirus (CMV) promoter/enhancer, at the appropriate developmental stages and in the tissues in which X-inactivation is normally first seen, embryos derived from transgenic males of line 53, which carries the intact YAC, were analysed for [beta]-galactosidase activity. In parallel, embryos derived from transgenic line 41, which carries LacZ but lacks most YAC PA-2 markers, as well as from another line carrying LacZ on an autosome-derived YAC (C.K, unpublished data), were analysed. In pre-implantation embryos (2-cell stage up to late blastocysts), no sign of LacZ gene silencing specific to the trophectoderm of late blastocysts, which is one of the first tissues in which an inactive X chromosome has been noted (28 ,29 ), could be detected for any of the transgenic mice including line 53 (Fig. 6 ). Furthermore, no differences in LacZ activity were found between the three transgenic lines at any of the post-implantation stages analysed (9.5-13.5 d.p.c, data not shown). The pattern of decreasing [beta]-galactosidase activity seen during pre-implantation stages and the highly tissue-specific post-implantation [beta]-galactosidase pattern observed for all three transgenic lines resembles that previously described for other CMV-controlled LacZ transgenes (30 ).
The aim of this study was to test whether part of the Xic candidate region including the Xist gene, while maintained as far as possible in its natural configuration in the form of a YAC transgene, is capable of undergoing inactivation at a non-X chromosomal location. We have studied a number of male and female mice carrying all or part of a 460 kb Xist-containing YAC for signs of inactivation within their transgenic sequences. None of these animals showed any evidence for YAC-induced inactivation, either in terms of Xist expression or in the silencing of other genes carried by the YAC.
Since it could be argued that in animals carrying only a single copy of the YAC transgene, the `trans-sensing' that may be required between two Xics in identical chromosomal configurations in order for X-inactivation to be initiated (31 ) may not have been reconstituted, we examined homozygous animals for two of the transgenic lines (53 and 80). No evidence for X-inactivation at the level of Xist expression was found in the homozygotes examined.
One possibility that must be considered is that embryonic lethality, associated with the insertion of the YAC transgene into an autosome, might lead to the loss of those animals in which the YAC was capable of undergoing inactivation. It is known for instance that in X-autosome translocations, where the X chromosome segment carries an Xic, X-inactivation can spread into neighbouring autosomal sequences to limited but variable extents, resulting in partial monosomy and possible haploinsufficiency for affected autosomal genes (32 ). We have no evidence for such an effect. The efficiency of transgenesis we observed was very similar to that obtained by others using pronuclear microinjection of YACs (33 ,34 ). The degree of fragmentation obtained was also comparable, despite the fact that our YAC was actually larger and therefore more susceptible to shearing (35 ). Furthermore, in addition to transgenic line 53 which contains the complete 460 kb YAC, animals containing incomplete segments of the YAC did not show any obvious systematic pattern of retention of DNA fragments, implying that there was no selection against the part of the YAC carrying Xist during embryogenesis (at least five of the nine founder animals generated carried Xist). Thus, whether inactivation was occurring or not, we observed no clear lethal effect due to the YAC's presence. In this context, it is worth noting that a recent analysis of a variety of radiation-induced autosomal deletions spanning several centimorgans indicated that up to 8% of the mouse genome can be viably deleted (36 ).
The finding that Xist is not expressed in any of the four animals carrying this part of the YAC that could be tested, suggests that the transgenic sequences are not in an `inactive X chromosome' state. In line 53, where the YAC transgene appears to be intact, the observation that the Cdx4 and Bpx transgenes are expressed as they would be from an active X chromosome, supports the idea that the transcriptional silence of Xist is probably a reflection of the `active X' status of the transgenic sequences. Although the presence of a duplication including Bpx and LacZ in line 53 meant that we could not distinguish whether one or both copies of these genes is expressed, the correct expression of the Cdx4 gene from the intact copy of the YAC and the physical continuity between this and the duplicated fragment make it unlikely that the transcriptional status of the duplicated genes would differ greatly. The correct, fully methylated status of a number of rare cutter sites in the YAC PA-2 sequences of lines 53 and 80 suggests that methylation patterns are being appropriately established for these transgenic sequences at their new chromosomal locations. Indeed, methylation studies on the 5' region of Xist (26 ,27 ) and the DXPas34 locus (23 ) (E.H., unpublished observations), whose profiles have previously been investigated with respect to X-inactivation, suggest that in the line 53 and 80 transgenes their methylation is in keeping with an `active X status'. Expression of the LacZ reporter gene in pre- and post-implantation embryos of line 53 also implies a lack of inactivation due to the YAC. Although we cannot exclude the possibility that the [beta]-galactosidase activity observed reflects an escape from inactivation of the CMV promoter/enhancer-driven LacZ gene, this seems unlikely, given the expression profiles of the other three genes tested in this line. It is worth mentioning in this regard that X-linked transgenes of bacterial origin (29 ) and driven by non-eukaryotic promoters (37 ) have previously been shown to undergo X-inactivation. In summary, the tissue-specific expression of the Cdx4 and Bpx genes, the methylation pattern of the transgenic region and the expression of the LacZ reporter gene during embryogenesis in line 53, suggest that Xist's transcriptional silence is not a consequence of the suppression of the entire transgenic domain as a result of some kind of position effect.
Matsuura et al. (50 ) have found a similar absence of Xist expression in a transgenic line where a Xist-containing YAC was present on an autosome. Their finding of some Xist expression in another transgenic line where multiple copies of a deleted form of this YAC are present on the heterochromatic long arm of the Y chromosome, raises the possibility, that surrounding hetero- chromatic sequences may favour Xist expression even in the absence of specific control elements.
In conclusion, of four transgenic lines carrying Xist, none showed expression of their transgenic copy. In one case (line 80) Xist was present in the context of 180-290 kb of surrounding sequence and in another (line 53) the entire 460 kb YAC was present and clearly not being subjected to transcriptional suppression. Thus, although the 310 kb region lying 3' to Xist and containing the Cdx4 and Bpx genes is intact and includes the necessary regulatory elements to ensure their tissue-specific expression, this 3' region and the 130 kb region lying 5' to Xist appear to be insufficient for Xist expression and X-inactivation. Recent data from Penny et al. (17 ) have demonstrated that the Xist gene is necessary in cis for X-inactivation to occur but has left open the question of whether it is sufficient for the initiation of X-inactivation. We suggest that the 460 kb YAC PA-2 region contains only some but not all of the sequences representing Xic and that key elements must be lacking. Such elements may include the Xce locus, which has been shown to be genetically separable from Xist and may well lie outside the YAC PA-2 region (24 ). Indeed, Penny et al. (17 ) suggest that as yet undefined elements lying 5' or 3' to Xist and regulating its expression may be essential for the correct initiation of X-inactivation. Our results are also consistent with data concerning inactivation of human tiny ring X chromosomes, which suggest that, even in the presence of XIST, X-inactivation cannot take place when sequences lying several hundred kilobases 5' to this gene are absent (38 ). Such data support the idea that the Xic might consist of several genetic loci spanning a much larger chromosomal region than that tested in this study. We are currently introducing YACs spanning a greater part of the candidate region for Xic into animals via an ES cell approach, with the hope that all of the necessary elements will be present together and in the appropriate configuration to permit the initiation of X-inactivation.
The left arm of YAC PA-2 was retrofitted by homologous recombination in yeast using standard techniques (39 ). The retrofitting plasmid, pL[beta]galA contains a yeast LYS2 gene inserted into pCMV[beta] (Clontech). The pL[beta]galA plasmid was targeted to the TRP1 left arm of the YAC by digestion with ScaI, which linearizes the plasmid within the ampr gene, and introduced into YAC PA-2 containing AB1380 cells by spheroplast transformation.
Purification of YAC DNA was carried out essentially as described (33 ) and injected at ~2 ng/µl into fertilized B6/SJL oocytes using standard methods (40 ). The integrity of the YAC DNA was tested by PFGE prior to injection. Transgenic founder animals were crossed with B6/SJL or SJL mice. F1 animals were subsequently crossed either with SJL mice or with the congenic 129.Pgk1a strain (23 ) in which part of the X chromosome linked to Pgk1a is derived from the M.musculus musculus PGK strain (41 ). Mice were raised in the animal house facilities of the Pasteur Institute.
PCR analysis of tail DNA was carried out as previously described for microsatellites DXPas28, DXPas29 and DXPas31 (24 ) LacZ(42 ) and URA3 (35 ). Southern analysis of EcoRI-digested tail or spleen DNA was carried out using standard procedures with nylon membrane (Hybond N+, Amersham) and hybridisations were performed as outlined (23 ) using [[alpha]-32P]dCTP-labelled probes (Megaprime kit, Amersham). PFGE was performed on mouse spleen cell DNA as described (25 ).
The probes used included the following (see Figs 1 and 3 ): YAC right arm, a 3 kb EcoRI-HindIII fragment derived from pYAC 4 (43 ) spanning the URA3 gene; YAC left arm, a 0.7 kb EcoRI-PstI fragment (AmpR) derived from pBR322 and a 3.7 kb NotI fragment (LacZ) derived from pCMV[beta] (Clontech); an anonymous genomic probe derived from the [lambda]IVC5 subclone of YAC PA-2 (44 ); Xist, a 3' cDNA probe (9 ) and various PCR amplification products derived from the Xist sequence (45 ) such as a 1.1 kb fragment (nt 26-1104); DXPas34 (23 ), DXPas19 (25 ) and DXPas27 (25 ) as described; a 5' Cdx4 probe (21 ); Bpx, a cDNA probe (22 ).
Metaphases from primary fibroblasts of transgenic mice were hybridised with YAC PA-2 probe labelled with dig-11-dUTP (Boehringer Mannheim) and detected with anti-dig-rhodamine (Boehringer Mannheim) (46 ). Each hybridisation was performed with 200 ng of YAC PA-2 and 5 µg of mouse Cot-1 DNA (GIBCO-BRL). Chromosomes were counter-stained with DAPI. Images were collected with a cooled CCD camera (C4880 Hamamatsu) mounted on an epifluorescent microscope (Axiophot Zeiss) and processed using a software program developed by Y. Usson (Grenoble).
First strand cDNA synthesized from 10 µg of total RNA, was prepared as previously described (9 ). One fiftieth of the cDNA was used for Xist PCR. Xist/Hprt co-amplification was performed as outlined (15 ) using Xist primers MIX10/MX20 and Hprt primers HPRTNAF/HPRTNAR. Semiquantitative PCR was performed using 10, 15 and 21 cycles. The resulting PCR products were resolved on 1.5% agarose gels which were blotted and hybridised sequentially with Xist and Hprt probes. PhosphorImager analysis (Molecular Dynamics) was used for quantitation of band intensities.
Primers within exon I of Xistthat detect a polymorphism between the C3H/He and SJL strains were used for SSCP analysis (CXU22, TTCTTCTCCTTAGCCCATC and CXL21, CCGTTGGGCATGGGAAAA). Labelled PCR was performed in a 10 µl reaction containing 1 µl of 10* PCR buffer (Amersham), 100 ng of genomic DNA or 1 µl of cDNA, 0.25 µM primers, 200 µM dNTPs, 0.1 µl of [[alpha]-32P]dCTP (3000 Ci/mmol, 10 mCi/ml, ICN). PCR involved 30 cycles at 94, 58 and 72oC for 1, 1 and 0.5 min respectively. Nine µl of the reaction was mixed with 9 µl of 95% formamide, 20 mM EDTA 0.05% bromophenol blue and 0.05% xylene cyanol, denatured at 95oC for 5 min, cooled on ice and 2 µl loaded onto a 5% acrylamide gel. Electrophoresis was performed at room temperature in 0.5* TBE for 1.5 h at 30 W with a ventilator. Gels were dried and exposed for 1-5 days at -80oC.
Bpx expression was investigated by direct SSCP analysis of brain cDNA exactly as described (22 ). As expression levels of the Cdx4 gene are low in adults, a first round of RT-PCR was performed on liver cDNA using primers situated in different exons (Cdx4 1a, AAGTATCGTGTGGTCTACAC and Cdx4 1b, TTCTAAGTTCTATGGCTAGG) (47 ) and SSCP analysis was then carried out on the agarose gel-purified cDNA product (884 bp) in order to avoid detection of genomic DNA contaminants. Primers within the 3'UTR of Cdx4 that detect a polymorphism between the C3H/He and PGK strains (Cdx4 5a, CACTCTTATTCCATGCTGTC and Cdx4 6b, AAATACAAGAGCATATGCAC) were used for SSCP analysis of the purified cDNA product. Labelled PCR was performed as for Xist and Bpx, with an annealing temperature of 52oC. Electrophoresis was performed on 5% acrylamide gels containing 5% glycerol, at 4oC in 0.5* TBE for 4 h at 30 W.
We thank C. Huxley for helpful advice concerning YAC manipulation and microinjection; M.-C. Simmler for use of her microsatellite markers; P. Baldacci for providing the autosomal control YAC; and V. Colot for comments on the manuscript. This work was supported by CNRS, AFM, GREG, ARC. E.H was supported by the Wellcome Trust.
1 Lyon, M.F. (1961) Gene action in the X chromosome of the mouse (Mus musculus L.) Nature, 190, 372-373.
2 Russell, L.B. (1983) X-autosome translocations in the mouse. Their characterisation and use as tools to investigate gene inactivation and gene action. In Sandberg, A.A. (ed.), Cytogenetics of the Mammalian X Chromosome. Part A. Basic Mechanisms of X Chromosome Behaviour. Alan R. Liss Inc., New York, pp. 205-250.
3 Therman, E. and Sarto, G.E. (1983) Inactivation center on the human X chromosome. In Sandberg, A.A. (ed.), Cytogenetics of the Mammalian X Chromosome. Part A. Basic Mechanisms of X Chromosome Behaviour. Alan R. Liss Inc., New York, pp. 315-325.
4 Lafrenière, R.G., Brown, C.J., Rider, S., Chelly, J., Taillon-Miller, P., Chinault, A.C., Monaco, A.P. and Willard, H.F. (1993) A 2.6 Mb YAC contig of the human X-inactivation center region in Xq13: physical linkage of the RPS4X, PHKA1, XIST and DXS128E genes. Hum. Mol. Genet., 2, 1105-1115.MEDLINE Abstract
5 Rastan, S. and Brown, S.D. (1990) The search for the mouse X chromosome inactivation centre. Genet. Res., 56, 99-106.MEDLINE Abstract
6 Cattanach, B.M., Rasberry, C., Evans, E.P. and Burtenshaw, M. (1989) Further Xce linkage data. Mouse News Lett., 83, 165.
7 Cattanach, B. and Williams, C.E. (1972) Evidence of non-random X-chromosome activity in the mouse. Genet. Res., 19, 229-240.MEDLINE Abstract
8 Brown, C.J., Ballabio, A., Rupert, J.L., Lafrenière, R.G., Grompe, M., Tonlorenzi, R. and Willard, H.F. (1991) A gene from the region of the human X-inactivation centre is expressed exclusively from the inactive X chromosome. Nature, 349, 38-44.MEDLINE Abstract
9 Borsani, G., Tonlorenzi, R., Simmler, M.C., Dandolo, L., Arnaud, D., Capra, V., Grompe, M., Pizzuti, A., Muzny, D., Lawrence, C., Willard, H.,F., Avner, P. and Ballabio, A. (1991) Characterisation of a murine gene expressed from the inactive X chromosome. Nature, 351, 325-329.MEDLINE Abstract
10 Brockdorff, N., Ashworth, A., Kay, G.F., Cooper, P., Smith, S., McCabe, V., Norris, D.P., Penny, G.D., Patel, D. and Rastan, S. (1991) Conservation of position and exclusive expression of mouse Xist from the inactive X chromosome. Nature, 351, 329-331.MEDLINE Abstract
11 Salido, E.C., Yen, P.H., Mohandas, T.K. and Shapiro, L.J. (1992) Expression of the X-inactivation associated gene Xist during spermatogenesis. Nature Genet., 2, 196-199.MEDLINE Abstract
12 McCarrey, J. R. and Dilworth, D.D. (1992) Expression of Xist in mouse germ cells correlates with X-chromosome inactivation. Nature Genet., 2, 200-203.MEDLINE Abstract
13 Rack, K.A., Chelly, J., Gibbons, R.J., Rider, S., Benjamin, D., Lafrenière, R.G., Oscier, D., Hendriks, R.W., Craig, I.W., Willard, H.F., Monaco, A.P. and Buckle, V.J. (1994) Absence of the XIST gene from late-replicating isodicentric X chromosomes in leukaemia. Hum. Mol. Genet., 3, 1053-1059.MEDLINE Abstract
14 Brown, C.J. and Willard, H.F. (1994) The human X-inactivation centre is not required for maintenance of X-chromosome inactivation. Nature, 368, 154-156.MEDLINE Abstract
15 Kay, G.F., Penny, G.D., Patel, D., Ashworth, A., Brockdorff, N. and Rastan, S. (1993) Expression of Xist during mouse development suggests a role in initiation of X chromosome inactivation. Cell, 72, 171-182.MEDLINE Abstract
16 Kay, G.F., Barton, S.C., Surani, M.A. and Rastan, S. (1994) Imprinting and X chromosome counting mechanisms determine Xist expression in early mouse development. Cell, 77, 639-650.MEDLINE Abstract
17 Penny, G.D., Kay, G.F., Sheardown, S.A., Rastan, S. and Brockdorff, N. (1996) The Xist gene is required in cis for X chromosome inactivation. Nature, 379, 131-137.MEDLINE Abstract
18 Brown, C.J., Hendrich, B.D., Rupert, J.L., Lafrenière, R.G., Xing, Y., Lawrence, J. and Willard, H.F. (1992) The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localised within the nucleus. Cell, 71, 527-542.MEDLINE Abstract
19 Borsani, G. and Ballabio, A. (1993) X chromosome gene dosage compensation in female mammals. Semin. Dev. Biol., 4, 129-139.
20 Brown, S.D. (1991) XIST and the mapping of the X chromosome inactivation centre. BioEssays,13, 607-612.MEDLINE Abstract
21 Horn, J.M. and Ashworth, A. (1995) A member of the caudal family of homeobox genes maps to the X-inactivation centre region of the mouse and human X chromosomes. Hum. Mol. Genet., 4, 1041-1047.MEDLINE Abstract
22 Rougeulle, C. and Avner, P. (1996) Cloning and characterisation of a murine brain specific gene Bpx and its human homologue within the Xic candidate region. Hum. Mol. Genet., 5, 41-49.MEDLINE Abstract
23 Courtier, B., Heard, E. and Avner, P. (1995) Xce haplotypes show modified methylation in a region of the active X chromosome lying 3' to Xist. Proc. Natl Acad. Sci. USA , 92, 3531-3535. MEDLINE Abstract
24 Simmler, M.-C., Cattanach, B.M., Rasberry, C., Rougeulle, C. and Avner, P. (1993) Mapping the murine Xce locus with (CA)n repeats. Mammalian Genome, 4, 523-530.MEDLINE Abstract
25 Heard, E. Simmler, M.C., Larin, Z., Rougeulle, C., Courtier, B., Lehrach, H. and Avner, P., (1993) Physical mapping and YAC contig analysis of the region surrounding Xist on the mouse X chromosome. Genomics,15, 559-569.
26 Norris, D.P., Patel, D., Kay, G., Penny, G.D., Brockdorff, N., Sheardown, S.A. and Rastan, S. (1994) Evidence that random and imprinted Xist expression is controlled by pre-emptive methylation. Cell,77, 41-51.MEDLINE Abstract
27 Hendrich, B.D., Brown, C.J. and Willard, H.F. (1993) Evolutionary conservation of possible functional domains of the human and murine XIST genes. Hum. Mol. Genet., 2, 663-672.MEDLINE Abstract
28 Takagi, N., Wake, N. and Sasaki, M. (1978) Cytological evidence for preferential inactivation of the paternally-derived X chromosome in XX mouse blastocysts. Cytogenet. Cell Genet., 20, 240-248.MEDLINE Abstract
29 Tan, S.-S., Williams, E.A. and Tam, P.P.L. (1993) X-chromosome inactivation occurs at different times in different tissues of the post-implantation mouse embryo. Nature Genet., 3, 170-174. MEDLINE Abstract
30 Kothary, R., Barton, S.C., Franz, T., Norris, M.L., Hettle, S. and Surani, M.A.H. (1991) Unusual cell specific expression of a major human cytomegalovirus immediate early gene promoter-lacZ hybrid gene in transgenic mouse embryos. Mech. Dev., 35, 25-31.MEDLINE Abstract
31 Muscatelli, F., Lena, D., Mettei, M.G. and Fontes, M. (1992) A male with two contiguous inactivation centres on a single X chromosome: study of X inactivation and XIST expression. Hum. Mol. Genet., 1, 115-119. MEDLINE Abstract
32 Rastan, S. (1983) Non-random X-chromosome inactivation in mouse X-autosome translocation embryos - location of the inactivation centre. J. Embryol. Exp. Morphol., 78, 1-22. MEDLINE Abstract
33 Peterson, K.P., Li, Q.L., Clegg, C.H., Furukawa, T., Navas, P.A., Norton, E.J., Kimbrough, T.G. and Stamatoyannopoulos, G. (1995) Use of yeast artificial chromosomes in studies of mammalian development: Production of [beta]-globin locus YAC mice carrying human globin developmental mutants. Proc. Natl Acad. Sci. USA, 92, 5655-5659.
34 Frazer, K.A., Narla, G., Zhang, J.L. and Rubin, E.M. (1995) The apoliprotein(a) gene is regulated by sex hormones and acute-phase inducers in YAC transgenic mice. Nature Genet., 9, 424-431. MEDLINE Abstract
35 Gnirke, A., Huxley, C., Peterson, K. and Olson, M.V. (1993) Microinjection of intact 200- to 500-kb fragments of YAC DNA into mammalian cells. Genomics, 15, 659-667.MEDLINE Abstract
36 Cattanach, B.M., Burtenshaw, M.D., Rasberry, C. and Evans, E.P. (1993) Large deletions and other gross forms of chromosome imbalance compatible with viability and fertility in the mouse. Nature Genet., 3, 56-61.MEDLINE Abstract
37 Dandolo, L., Stewart, C.L., Mattei, M.-G. and Avner, P.R. (1993) Inactivation of an X-linked transgene in murine extraembryonic and adult tissues. Development, 118, 641-649.MEDLINE Abstract
38 Migeon, B.R., Luo, S., Stasiowoki, B.A., Jani, M., Axelman, J., Van Dyke, D.L., Weiss, L., Jacobs, P.A., Yang-Feng, T.L. and Wiley, J.E. (1993) Deficient transcription of XIST from tiny ring X chromosomes in females with severe phenotypes. Proc. Natl Acad. Sci. USA, 90, 12025-12029.MEDLINE Abstract
39 Rose, M.D., Winston, F. and Hieter, P. (1990) Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
40 Hogan, B., Constantini, F. and Lacy, E. (1986) Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
41 Johnston, P.G. and Cattanach, B.M. (1981) Controlling elements in the mouse. IV. Evidence of non-random X-inactivation. Genet. Res. Camb., 37, 151-160.
42 Hanley, T. and Merlie, J.P. (1991) Transgene detection in unpurified mouse tail DNA by PCR. Biotechniques, 10, 56.MEDLINE Abstract
43 Burke, D.T., Carle, G.F. and Olson, M.V. (1987) Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science, 236, 806-812.MEDLINE Abstract
44 Rougeulle, C., Colleaux, L., Dujon, B. and Avner, P. (1994) Generation and characterisation of an ordered lambda clone array for the 460 kb region surrounding the murine Xist sequence. Mammalian Genome, 5, 416-423.MEDLINE Abstract
45 Brockdorff, N., Ashworth, A., Kay, G.F., Cooper, P.J., Swift, S. and Rastan, S. (1992) The product of the mouse Xist gene is a 15 kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell, 71, 515-526.MEDLINE Abstract
46 Lichter, P. (1988) High resolution mapping of human chromosome 11 by in situ hybridisation with cosmid clones. Science, 247, 64-69.
47 Gamer, L.W. and Wright, C.V.E. (1993) Murine Cdx4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern. Mech. Dev., 43, 71-81.MEDLINE Abstract
48 Vernet, M., Bonnerot, C., Briand, P. and Nicolas, J.F. (1994) Application of LacZ gene fusions to preimplantation development. Methods Enzymol., 225, 434-451.
49 Bonnerot, C. and Nicolas, J.-F. (1994) Application of LacZ gene fusions to postimplantation development. Methods Enzymol., 225, 451-469.
50 Matsuura, S., Episkopou, V. and Brown, S. D. M. (1996) Xist expression from an Xist YAC transgene carried on the mouse Y chromosome. Hum. Mol. Genet.5, 451-459.MEDLINE Abstract
*To whom correspondence should be addressed
This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:07 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
