Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pandya, A.
Right arrow Articles by Nance, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandya, A.
Right arrow Articles by Nance, W. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 497-503

Phenotypic variation in Waardenburg syndrome: mutational heterogeneity, modifier genes or polygenic background?
Introduction
Results
   Clinical observations
   Mutation detection by SSCP analysis
   Results of sequencing
Discussion
Materials And Methods
   DNA purification
   PCR-SSCP method
   Sequence analysis
   Restriction enzyme digestion/allele specific hybridization
Acknowledgement
References


Phenotypic variation in Waardenburg syndrome: mutational heterogeneity, modifier genes or polygenic background?

Phenotypic variation in Waardenburg syndrome: mutational heterogeneity, modifier genes or polygenic background? Arti Pandya1,*, Xia-Juan Xia1, Barbara L. Landa1, Kathleen S. Arnos2, Jamie Israel2, Joyce Lloyd1, Anthony L. James1, Scott R. Diehl3, Susan H. Blanton4 and Walter E. Nance1

1Department of Human Genetics, Medical College of Virginia, Richmond, VA 23298, USA, 2Gallaudet University, Washington D.C. 20002, USA, 3Molecular Epidemiology and Disease Indicators Branch, DEODP, NIDR, National Institutes of Health, Bethesda, Maryland 20892, USA and 4Department of Pediatrics, University of Virginia, Charlottesville, Virginia 22908, USA

Received November 21, 1995; Revised and Accepted January 19, 1996

We have identified 11 mutational changes in the PAX3 gene in patients with type 1 Waardenburg syndrome (WS1) including three in the paired domain, six within or immediately adjacent to the homeodomain and two previously described polymorphic variants in exons 2 and 6. The affected members of one family carried substitutions involving two base pairs separated by one unaltered codon. Two of the deleterious mutations were identical and three others were identical to previously reported mutations. A comparison of clinical findings in families carrying substitutions in the same codon failed to reveal conspicuous similarities. Although subtle mutation-specific effects may well exist, allelic heterogeneity clearly cannot account for within family variation. However, the striking concordance of a pair of monozygotic twins with Waardenburg syndrome (WS) and previous reports of similar pairs indicate that phenotypic variation in WS has a genetic basis. If the genetic effects are mediated by oligogenic epistasis, as studies in the mouse suggest, it may ultimately be possible to predict clinically relevant aspects of the Waardenburg phenotype.

INTRODUCTION

Waardenburg syndrome is an autosomal dominant disorder of neural crest differentiation which was first described in 1948 by a Dutch ophthalmologist (1 ). The cardinal features include deafness, dystopia canthorum and pigmentary changes of the eyes, hair and skin. Less common but clinically relevant findings include spina bifida (2 ,3 ), Hirschsprung disease (4 ) and gastrointestinal dysmobility (5 ). The phenotype is quite variable, even within sibships. Clinically the syndrome has been classified into three types. The Waardenburg Syndrome Consortium developed a diagnostic algorithm for WS1 which includes consideration of family history, major and minor features, and a numerical estimate of the canthal index (6 ,7 ). WS type 2 (WS2) differs from type 1 in that dystopia canthorum is generally absent. WS type 3 (WS3) is a more severe form in which there are associated limb abnormalities. All or most WS1 cases are caused by mutations at the PAX3 locus on 2q35 while all or most WS2 families are unlinked to PAX3. WS3 can result from homozygosity for a PAX3 mutation (8 ) or reflect an unusual manifestation of the heterozygous phenotype (9 ,10 ). PAX3 belongs to a family of genes which code for structurally related transcription factors. The PAX3 protein contains two highly conserved DNA binding motifs, a paired domain and a paired type homeobox, as well as a highly conserved octapeptide and a 3' Ser-Thr-Pro rich region which is involved in transcriptional activation (11 ,12 ). The recessive splotch mutation in the murine homolog of PAX3 is associated with pigmentary, craniofacial and auditory abnormalities (13 ) as well as spina bifida (14 ). Developmental studies have shown that Pax-3 is expressed in early neurogenesis in the spinal cord and brain as well as in the embryonic precursors of neural crest cells, the craniofacial mesectoderm and limb mesenchyme (15 ). Approximately 20% of WS2 mutations map to the human homolog of the mouse microphthalmia locus (MITF) on 3p12 (16 ). Other families which include many features of WS2 along with Hirschsprung's disease are caused by mutations in the endothelin-B receptor locus (EDNRB) on 13q22 (17 ). Finally some families with piebaldism resulting from mutations in KIT on 4q12 can exhibit features which mimic WS.

To date, more than 40 mutations in the PAX3 gene have been reported (18 -20 ) including changes in the paired and homeo domains and in the 3' Ser-Thr-Pro rich region of the gene. Virtually all previously reported mutations have been `private' or unique to single families which has frustrated attempts to correlate phenotypic variation with specific mutations. Our goals are to further characterize the spectrum of PAX3 mutations seen in patients with WS1, to compare the phenotypic features of the syndrome in families with the same or similar mutations, and to show that even within family variation in WS is genetic in origin.

Table 1 Clinical features
Family

Ethnic

No.

Deaf

Average

Hypopigmentation

no.

origin

affected

 

W-index

Iris

White

Poliosis

Skin

GI

 

 

 

 

 

 

forelock

013

Am.Indian/

5

2*

2.21

2*

2

4

2*

no

 

English/Irish

052

French

5

4*

-

0

2

0

1

no

002

Italian

12

2*

2.82

2*

3

8

4*

no

003

Unknown

6

3*

2.36

0

1

2

1*

no

056

Possible Irish

2

1*

2.39

1*

1*

1

2*

no

029

Irish/English

14

9*

2.40

2

8*

2

2

no

 

Italian/Am Ind/

 

German

050

German

9

0

2.44

4*

0

5*

0

no

027

German/Dutch

8

4*

2.31

3

0

4

2

no

*Feature exhibited by proband.

Table 2 . Primers used to amplify and sequence exons 2-8
Exon

Primer A

Primer B

2

5'GAAGACTGCGAAATTACGTGCTGC3'

5'GACCACAGTCTGGGAGCCAGGAGG3'

3

CAGAGGCGGTGGGGCCGCCGCCAC

GTCGACGTGCCGGGGTAATAGCGA

4

AGCCCTGCTTGTCTCAACCATGTG

TGCCCTCCAAGTCACCCAGCAAGT

5

GAGAGAACTTGGATTCAATCTCAG

CCTGTCTGGACTGAAGTAGGACAC

5

GGTATAGGGATCACTGTAATGGTG

CAATATGCATCCCTAGTAAAGGGC

6

ACTATTATTTCATCAGTGAAATCC

ATAAAATATCCACCAGAGAAATCG

7

TGCACTGAACTTTCTCTGCTGGCC

CTGGTATACAGCAAATCGTCTGTC

8

CTCTTTTTTTAGGTAATGGGAC

GAGTTTATCTCCCTTCCAGG

RESULTS

Clinical observations

This report is based on 11 families with a clinical diagnosis of WS1 ascertained from the Genetics Clinic of the Medical College of Virginia and the Genetic Services Center at Gallaudet University in Washington D.C. A total of 89 available members in the 11 families were examined using the Waardenburg Consortium protocol. Table 1 shows the distribution of clinically defined or anamnestic features in the 61 affected members of eight families in which a pathologic mutation was detected. The W-Index was calculated using the formula proposed by Arias (6 ), and the mean for each family is given. A cut off of greater than 1.95 is considered diagnostic of WS1. Patients with either unilateral or bilateral hearing loss are classified as affected with deafness in the table. None of the affected individuals manifest gastrointestinal symptoms. Clinical data on the two families in whom polymorphic PAX3 variants were detected are not shown in the table. The eleventh family included an affected pair of 21 year old female twins in whom a PAX3 mutation has not yet been identified. The twins were reportedly dichorionic but typing for six polymorphic DNA markers yielded a probability of monozygosity of greater than 0.999. The twins were concordant for dystopia, blue irides, chronic constipation and profound sensorineural hearing loss, with remarkably similar audiograms.

Mutation detection by SSCP analysis

All affected and normal family members were screened for single stranded conformational polymorphism (SSCP) changes in exon 2 through 8 of the PAX3 gene. The primers used for amplification of these exons are shown in Table 2 . These primers were designed to include the intron-exon boundaries based on the sequence structure reported by Burri et al. (21 ), and Tassabehji et al. (22 ). To assess the frequency of non pathologic base pair substitutions, 25 normal controls were also screened in addition to the unaffected family members. All of the controls yielded normal test results. A positive SSCP result was characterized by the presence of extra bands on the autoradiogram. Figure 1 a shows an example of such a mobility shift seen in exon 5 for family VCU 56.

Results of sequencing

Once a putative mutation was detected by SSCP analysis, confirmation was achieved by direct sequencing and by cloning and sequencing the double stranded product from one affected and one normal member from each family. The mutation was confirmed in other affected members by restriction enzyme digestion or by allele specific oligonucleotide hybridization. A summary of the mutations is given in Table 3 .

Table 3 . Mutations identified in WS1 patient population
VCU

Mutation

Location*

Domain

WS Phenotype

Family #

013

Gly48 -> Arg (G -> C)142

E-2

PD

I

052

1 bp deletion of (C)169

E-2

1st helix

I

 

 

 

N-terminal - PD

I

002

Gln75 -> Term (C -> T)223

E-2

2nd helix

I

 

 

 

N-terminal - PD

I

003+

Glu210 -> Term (G -> T)628

E-5

5' to HD

I

056+

Glu210 -> Term (G -> T)628

E-5

5' to HD

I

029

Arg223 -> Term (C -> T)667

E-5

HD

I

050

Arg270 -> Cys (C -> T)808

E-6

3rd helix - HD

I

027

Arg271 -> His (G -> A)812

E-6

3rd helix - HD

I

 

Arg273 -> Lys (G -> A)818

E-6

3rd helix - HD

I

*E, exon; I, intron; PD, paired domain; HD, homeodomain; Term, termination codon; +, families with identical mutation


Figure 1. (a) Pedigree and results of SSCP analysis in family VCU 56. Affected mother and son possess extra bands as indicated by arrows. (b) Direct sequencing of exon 5 in family VCU 56 demonstrates G628 -> T nonsense mutation. A, affected; N, normal.Three of the mutations are in exon 2, in the N-terminal region of the paired domain. Two of these are single base pair substitutions, one resulting in a nonsense mutation in the second helix of the domain (family VCU 2); the other is the substitution of an arginine residue for glycine at codon 48 (family VCU 13). Confirmation of substitution in other family members by ASO is illustrated in Figure 2 . The third mutation (family VCU 52) involves a frameshift deletion of a single base pair at nucleotide 169 in the first helix of the N-terminal region of the paired domain, resulting in a premature termination codon 157 bp downstream. The truncated protein product lacks the homeodomain, the Ser-Thr-Pro rich region and the normal carboxyl terminus.


Figure 2.Allele specific oligonucleotide hybridization on affected and normal members in family VCU 13. Affected individuals (AFF) demonstrate hybridization to both normal and mutated oligonucleotide (1-4), whereas unaffected members hybridize only to the normal probe (5-8).

Two changes are identical nonsense mutations Glu210 -> Term (G -> T)628, located within exon 5, just 5' to the homeodomain region (families VCU 3 and VCU 56; Fig. 1 b). Their products also lack all of the homeodomain and carboxyl terminus involved in DNA binding. Typing of the two mutations for the CA repeat polymorphism (23 ) which begins at 702 bp upstream from the initiation codon within the 5' regulatory region of the gene showed that both carried a repeat which was 26 dinucleotides in length.

Four other mutations are identified at different sites within the homeodomain. In family VCU 29 a nonsense substitution generates a chain termination signal in codon 223 five amino acids after the start of the homeodomain. An identical mutation has been reported previously by Baldwin (18 ). Two other substitutions occur in adjacent arginine residues at codons 270 and 271 in the third helix of the homeodomain (families VCU 27 and VCU 50). Interestingly, the PAX3 gene in family VCU 27 has a second substitution 6 bp downstream. In this family, the two arginine residues at codon 271 and 273 are replaced with histidine and lysine respectively (Fig. 3 ). This double amino acid substitution was confirmed by allele specific oligonucleotide (ASO) testing. DNA samples from all eight affected family members hybridized with an oligonucleotide containing both substitutions, but not with oligonucleotides containing either of the single substitutions.


Figure 3.Sequencing of clones of exon 6 in family VCU 27. N is normal DNA and A is affected. The arrows demonstrates G -> A substitutions in codons 271 and 273 in the affected individual.

In addition to these deleterious mutations we also observed one synonymous G -> T base pair substitution involving Arg43 in exon 2 as well as an amino acid substitution Thr315 -> Lys(C -> A)944 in the Ser-Thr-Pro rich 3' region of the gene. The Arg43 mutation and Thr315 substitution have previously been reported by Tassabehji (20 ,22 ) and both of these changes are quite likely polymorphisms.

DISCUSSION

We describe nine exonic mutations in the PAX3 gene which cause WS1. Six of the mutational changes have not been described previously but two of these are identical, and the remaining three are the same as previously described changes. Three mutations involve the paired domain in exon 2 and include one amino acid replacement, one nonsense substitution, and a single base pair frameshift deletion. The Gly48 -> Arg substitution in family VCU 13 changes a residue conserved in all nine of the PAX proteins as well as in the paired domains of the Drosophila paired, gooseberry and gooseberry neuro genes (24 ). A substitution in the same amino acid (Gly -> Ser) in the Pax-1 protein results in the undulated mutation in the mouse (25 ). In the Drosophila paired protein, Gly48 contacts the sugar phosphate backbone and also makes base contacts in the minor groove (24 ). These data are all consistent with the deleterious effects observed with the polar Gly48 -> Arg substitution in family VCU 13. Six mutations occur within or near the homeodomain in exons 5 and 6, and include three nonsense substitutions and the replacement by nonpolar amino acids of adjacent arginine residues at positions 270 and 271 within the third helix of the homeodomain. This is a region known to be involved in DNA recognition. The Arg271 is a highly conserved residue that is directly involved in the binding of the homeodomain of the Drosophila paired protein to the phosphate backbone in the major groove of DNA (26 ). This substitution was accompanied by a second replacement of Arg273 -> Lys. The polar amino acid lysine is also found at this position in PAX6 (27 ) and several other homeodomain genes (26 ). In PAX3, a single substitution at this site could therefore represent a polymorphism or possibly result in a gain of function. Although the occurrence of a double substitution is unusual, it is not without precedent; similar events have been described at the cystic fibrosis locus (28 ). As noted below, the Arg271 replacement alone can cause WS1, but it is not clear what effect the isolated replacement of Arg273 by lysine would have, if any. Possibly, in the presence of one harmful mutation at Arg271, selection against further changes in the gene may be relaxed.

The two identical nonsense mutations in the homeodomain are Glu210 -> Term (G -> T)628 substitutions, while the third is identical to the Arg -> Term (C -> T)667 substitution reported previously by Baldwin et al. (18 ). These investigators noted that chain termination appears to occur with greater frequency among homeodomain mutations whereas amino acid substitutions are more frequent in the paired domain. While we have now observed a nonsense mutation in the paired domain as well (family VCU 2), our observation of two recurrent nonsense substitutions within the homeodomain is consistent with their findings. Tassabehji et al. (20 ) have characterized the region extending from amino acids 266-271 in the homeodomain as being a mutational `hot spot'. Our observation of two recurrent mutations in this region, including the fourth reported substitution involving the first two base pairs of the Arg271 codon, and a double mutation involving that codon and a nearby residue are consistent with their interpretation. However, it will be important to compare the haplotypes and ethnic origins of `recurrent' mutations in this region to exclude a founder effect, as in the case of some BRCA1 mutations (29 ). The general similarity in the phenotypic effects of WS1 mutations suggests haploinsufficiency as the causal mechanism. Our failure to observe substitutions of amino acids in the PAX3 homeodomain that are directly involved in DNA sequence recognition may indicate that some of these substitutions result in a gain of function that is either lethal or not recognizable as WS1. Baldwin et al. (18 ) found that deafness was more common in patients who carry a mutation in the paired domain. When we include subjects in whom historical data were available along with those who were examined, the two groups do not differ significantly in our data: deafness is present in eight of 22 subjects (36%) with a paired domain mutation and 17 of 39 (43%) with mutations elsewhere in the gene.

Our discoveries provide an opportunity to compare the effects of the same mutational changes in different families. In families VCU 3 and VCU 56 identical nonsense substitutions result in a premature chain termination, nine codons 5' to the start of the homeodomain. Phenotypic data was available on the proband and adopted mother in family VCU 56 and on six affected members of family VCU 3 (Table 1 ). Features in common include dystopia, deafness, white forelock, poliosis and skin hypopigmentation. The proband in family VCU 56 also had heterochromia. Since the two WS1 genes had the same repeat number at the polymorphic CA repeat in the 5' regulatory region of the gene, they may be descendants of a common ancestor. Further characterization of the haplotypes will evaluate the possibility.

In family VCU 27, we observed an Arg271 -> His (G -> A)812 and an Arg273 -> Lys (G -> A)818 substitution. Lalwani et al. (19 ) have described a different substitution of arginine 271 by glycine. In their family, all six affected members had dystopia canthorum. Hearing impairment and premature greying was noted in five of the six and two had brilliant blue eyes or heterochromia. In our family there is hearing loss and premature greying in four of eight affected family members and iris hypopigmentation in three of eight. Tassabehji et al. (20 ) also reported a family with an isolated Arg271 -> His (G -> A)812 substitution but did not describe the clinical findings.

The Arg223 -> Term (C -> T)667 nonsense substitution within the homeodomain in family VCU 29 is identical to a mutation described previously by Baldwin (18 ). Their family contained a high proportion of affected individuals with premature greying and heterochromia irides, but not white forelock. In our family, nine of 14 affected individuals had deafness, eight had a white forelock, and two had iris hypopigmentation.

In family VCU 50 the Arg270 -> Cys (C -> T)808 substitution is identical to the mutation recently described by Tassabehji et al. (20 ). Our family was of German extraction, but details about the ethnic origin and clinical features of the previously reported family were not provided.

Although the effects of these homologous substitutions are not conspicuously similar, as more data on recurrent mutations accumulate, it should be possible to conduct rigorous tests for variation in the effects of different WS1 mutations. In a multivariate factor analysis of the WS phenotype, Reynolds et al. (30 ) have shown that the clinical features cluster into a Facial Factor, comprised of dystopia, synophrys and hypoplasia of the nasal alae, and a Pigmentary Factor including deafness, white forelock, and hypopigmentation of the skin and irides. A comparison of the factor scores within and among families with the same mutations would permit the tests for effects specific to particular mutations.

Although subtle mutation specific effects may ultimately be demonstrable, it already seems clear that mutational heterogeneity can not account for the substantial phenotypic variation that exists between and within families carrying the same mutation. Our observations on the concordance of monozygotic (MZ) twins with WS strongly suggest that variation in the expression of WS is genetically determined. The pair we report are concordant for dystopia, bilateral blue eyes, chronic constipation and profound sensorineural deafness with remarkably similar audiograms. Waardenburg (31 ) refers to two similar MZ pairs who were also concordant for deafness (32 ,33 ). From these observations, we cannot infer whether the genetic effects are mediated by the `polygenic background' or by interactions with specific genetic modifiers. However, Puffenberger et al. (34 ) recently mapped a recessive gene for Hirschsprung disease to the endothelin B receptor (EDNRB) locus on 13q22. Many affected family members showed features of WS including deafness and pigmentary abnormalities. The authors used identity-by-descent and association mapping to detect an anonymous locus at 21q22 which appears to modify the phenotypic expression of the EDNRB gene. In the mouse, Ednrb mutations cause the Piebald phenotype which varies greatly in different mouse strains. Paven et al. (35 ) mapped six modifier loci which explained virtually all of these differences including three plausible candidates: Mgf, Kit and e. Thus, mutations at a cluster of genes that influence melanocyte function can produce effects in man or the mouse which are quite variable and exhibit considerable phenotypic overlap. In man, the `melanocyte cluster' may include PAX3, KIT, EDNRB and its ligand EDN3, MITF, MGF, RET, MSHR and its ligand MSH, as well as OCA1 and OCA2 which are known to exhibit epistatic interactions (36 ). In the presence of a major gene at one of these loci, dominant or recessive epistatic modifiers at other members of the cluster may account for phenotypic variation in the expression of the major gene. This postulated system of oligogenic epistases within gene clusters is very different from either multifactorial or polygenic transmission where the genetic effects are assumed to result from the small additive contributions of genes at many loci. If applicable to WS, knowledge of the genotype at relevant modifier loci may allow prediction and possibly the treatment of clinically relevant aspects of the phenotype, including deafness, gastrointestinal dysmobility, Hirschsprung disease or spina bifida. Finally, because of its associated pleotropism the deafness in WS can be recognized as being genetic even though its penetrance is only 20%. For other gene clusters, such as those affecting blood pressure, cancer, Alzheimers disease, cleft palate, or schizophrenia, the major locus may not exhibit pleiotropy and cases resulting from oligogenic epistasis may be falsely identified as sporadic or nongenetic. A more complete understanding of gene expression in the melanocyte cluster could thus provide insights that are relevant to many other common genetic diseases.

MATERIALS AND METHODS

DNA purification

DNA was isolated from whole peripheral blood specimens or transformed lymphocytes using the inorganic method of extraction described by Bell et al. (37 ).

PCR-SSCP method

A quantity of 500 ng of genomic DNA was amplified in a 25 µl volume containing 2.5 mM MgCl2, 200 µM each of dATP, dGTP, dCTP and 20 µM dTTP, 10 pmol of each oligonucleotide primer, 0.1 µl [32P]dTTP (800 Ci/mmole) and 2.5 U Taq Polymerase. After initial denaturation for 4 min at 94oC, 30 cycles of amplification were performed as follows: denaturation (1 min at 94oC), annealing (1 min at 68oC), and extension (1.5 min at 72oC), followed by a final 10 min extension at 72oC. Five µl of PCR product were diluted in 10 µl quench buffer (0.1% sodium dodecyl sulfate in 10 mM ethylene diamine tetraacetic acid) and 12.5 µl 20 mM EDTA in 98% formamide containing 0.05% each of bromophenol blue and xylene cyanol. The samples were denatured for 8 min at 85oC and rapidly cooled on ice. Five µl aliquots were loaded onto a 8% polyacrylamide (acrylamide/bisacrylamide ratio of 49:1) with 5% glycerol 38 × 50 cm nondenaturing sequencing gel in 1* TBE buffer.

Electrophoresis was carried out in 0.5* TBE upper buffer and 1* TBE lower buffer, at room temperature at 5 W for 12.5 h and 20 W for 11 h. Cold room gels were run without glycerol at 50 W for 10-14 h. Gels were dried and exposed overnight to an autoradiogram with an intensifying screen at -70oC.

Sequence analysis

Genomic DNA from each individual was amplified using primers for exons 2 through 8 shown in Table 2 . Cycling was performed on a Perkin Elmer 9600 thermal cycler for 35 cycles with the optimal annealing temperature varying from 58oC to 68oC for each exon.

The PCR product was quantitated using a [lambda] DNA standard on a 3% NuSieve Gel. For direct sequencing the sequence PCR Product Sequencing Kit marketed by USB was used according to their protocol.

Cloning of DNA fragments for sequencing was performed using the Eukaryotic TA Cloning Kit marketed by Invitrogen. Subsequently plasmid DNA was isolated using the DNA miniprep kit (Bio-RAD) and 10 µg was used to sequence using the Sequenase version 2.0 DNA Sequencing Kit (USB).

Restriction enzyme digestion/allele specific hybridization

The exon 5 mutation in family VCU 29 was confirmed in the rest of the affected members using AlwNI restriction enzyme digestion.

Exon 2 changes in family VCU 13, and exon 6 changes in families 27 and 50 (example Fig. 2 ), were confirmed in all the affected members by allele specific hybridization using a slight modification of the method described by Thein (38 ).

ACKNOWLEDGEMENT

The authors gratefully acknowledge the technical help of Wanda Hunt and Razieh Javaheri. We also thank Drs J. P. Fryns and J. J. Cassiman from the University of Leuven, Leuven, Belgium, for referring family VCU 52 for study. This work was supported by research grant number 5 R01 DC 00038-05 from the National Institute on Deafness and other Communication Disorders, NIH.

REFERENCES

1 Waardenburg, P.J. (1951) A new syndrome combining developmental anomalies of the eyelids, eyebrows and nose root with pigmentary defects of the iris and head hair and with congenital deafness. Am. J. Hum. Genet. 3: 195-253.

2 Arnos,K.S., Pandya,A., Markello,T., Israel,J., Landa,B., Blanton,S. and Nance,W.E. A kindred with unusual features of Waardenburg syndrome and familial tremor. [Abstract] (1994) Am. J. Hum. Genet. 55: 426.

3 Chatkupt,S., Chatkupt,S., Johnson,W.G. (1993) Waardenburg syndrome and myelomeningocele in a family. J. Med. Genet. 30: 83-84. MEDLINE Abstract

4 Omenn,G.S. and McKusick,V.A. (1979) The association of Waardenburg syndrome and Hirschsprung megacolon. Am. J. Med. Genet. 3: 271-275.

5 Valenzuela,G., Weber, F.H., Nance,W. and McCallum,R.W. (1995) Waardenburg syndrome and gastric stasis in adults. V.M.Q. 122: 279-280.

6 Arias,S. and Mota M. (1978) Apparent non-penetrance for dystopia in Waardenburg syndrome type 1, with some hints on the diagnosis of dystopia canthorum. J. Genet. Hum. 26: 103-131. MEDLINE Abstract

7 Farrer,L.A., Grundfast,K.M., Arnos,J., Arnos, K.S., Asher, J.H. Jr., Beighton, P., Diehl, S.R. and Fex, Jorgen. (1992) Waardenburg syndrome (WS) type 1 is caused by defects at multiple loci, one of which is near ALPP on chromosome 2: First report of the WS Consortium. Am. J. Hum. Genet. 50: 902-913. MEDLINE Abstract

8 Zlotogora, J., Lerer, I., Bar-David, S., Ergaz, Z. and Abeliovich, D. (1995) Homozygosity for Waardenburg syndrome. Am. J. Hum. Genet. 56:1173-1178. MEDLINE Abstract

9 Hoth, C.F., Milunsky, A., Lipsky, N., Sheffer, R., Clarren, S.K. and Baldwin, C.T. (1993) Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome Type 1 (WS-1). Am. J. Hum. Genet. 52:455-462. MEDLINE Abstract

10 Pasteris, N.G., Trask, B.J., Sheldon, S. and Gorski, J.L. (1993) Discordant phenotype of two overlapping deletions involving the PAX3 gene in chromosome 2q35. Hum. Mol. Genet. 2:953-959. MEDLINE Abstract

11 Chalepakis,G., Jones,F.S., Edelman,G.M. and Gruss,P. (1994) Pax-3 contains domains for transcription activation and transcription inhibition. Proc. Natl Acad. Sci. USA 91: 12745-12749. MEDLINE Abstract

12 Bennicelli,J.L., Fredericks,W.J., Wilson,R.B., Rauscher,F.J. and Barr,F.G. (1995) Wild type PAX3 protein and the PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma contain potent, structurally distinct transcriptional activation domains. Oncogene 11: 119-130. MEDLINE Abstract

13 Asher, J.H. Jr., Gillikin, L., Swenson,L.B., Dolan,D.F., Morell, R., and Friedman, T.B. (1995) Hearing and deaf splotch mice: A murine model for deafness in Waardenburg syndrome? In: The Molecular Biology of Hearing and Deafness, Bethesda, Maryland, USA, October 6-8 , 1995, p. 46.

14 Moase,C.E. and Trasler,D.G. (1992) Splotch locus mouse mutants: models for neural tube defects and Waardenburg syndrome type 1 in humans. J. Med. Genet. 29: 145-151. MEDLINE Abstract

15 Goulding,M.D., Chalepakis,G., Deutsch,U., Erselius,J.R. and Gruss,P. (1991) Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. 10: 1135-1147. MEDLINE Abstract

16 Hughes, A.E., Newton, V.E., Liu, X.Z. and Read, A.P. (1994) A gene for Waardenburg syndrome type 2 maps close to the human homologue of the mouse microphthalmia gene at chromosomal location 3p12p14.1. Nature Genet. 7:509-512. MEDLINE Abstract

17 Puffenberger, E.G., Hosoda, K. and Washington, S.S. (1994) A missence mutation of the endothelin-B receptor gene in multigenic Hirschsprung's disease. Cell 79:1257-1266. MEDLINE Abstract

18 Baldwin, C.T., Hoth, C.F., Macina, R.A. and Milunsky, A. (1995) Mutations in PAX3 that cause Waardenburg syndrome type I: Ten new mutations and review of the literature. Am. J. Med. Genet. 58:115-122. MEDLINE Abstract

19 Lalwani, A.K., Brister, J.R., Fex, J., Grundfast, K.M., Ploplis, B., San Agustin, T.B. and Wilcox, E.R. (1995) Further elucidation of the genomic structure of PAX3, and identification of two different point mutations within the PAX3 homeobox that cause Waardenburg syndrome type 1 in two families. Am. J. Hum. Genet. 56:75-83. MEDLINE Abstract

20 Tassabehji,M., Newton,V.E., Lice,X., Brady,A., Donnai,D., and Krajewska-Walasek,M. (1995) The mutational spectrum in Waardenburg syndrome. Hum. Mol. Genet. 4: 2131-2137. MEDLINE Abstract

21 Burri, M., Tromvoukis, Y., Bopp, D., Frigerio, G. and Noll, M. (1989) Conservation of the paired domain in metazoans and its structure in three isolated human genes. EMBO J. 8:1183-90. MEDLINE Abstract

22 Tassabehji, M., Newton, V.E., Turnbull, K., Seemanova, E., Kunze, J., Sperling, K., Strachan, T. and Read, A.P. (1994) PAX3 gene structure and mutations: close analogies between Waardenburg syndrome and the splotch mouse. Hum. Mol. Genet. 3: 1069-1074. MEDLINE Abstract

23 Wilcox,E.R., Rivolta,M.N., Ploplis,B., Potteri,S.B. and Fex,J. (1992) The PAX3 gene is mapped to human chromosome 2 together with a highly informative CA dinucleotide repeat. Hum. Mol. Genet. 1: 215. MEDLINE Abstract

24 Xu,W., Rould,M.A., Jun,S., Desplan,C. and Pabo,C.O. (1995) Crystal structure of a paired doman-DNA complex at 2.5 resolution reveals structural basis for Pax developmental mutations. Cell 80: 639-650. MEDLINE Abstract

25 Balling,R., Deutsch,U. and Gruss,P. (1988) undulated, a mutation affecting the development of the mouse skeleton, has a point mutation in the paired box of Pax-1. Cell 55: 531-535. MEDLINE Abstract

26 Wilson,D.S., Guenther,B., Desplan,C. and Kuriyan,J. (1995) High resolution crystal structure of a paired (Pax) class cooperative homeodomain dimer on DNA. Cell 82: 709-719. MEDLINE Abstract

27 Martin, P., Carriere, C., Dozier, C., Quatannens, B., Mirahel, M.A., Vandenbunder, B., Stehelin, D. and Saule, S. (1992) Characterization of a paired box- and homeobox- containing quail gene (Pax-QNR) expressed in the neuroretina. Oncogene 7,1721-1728. MEDLINE Abstract

28 Macek, M., Vavrova, V., Davis, C.L., Hamosh, A. and Cutting, G.R. (1993) Two F508 homozygote siblings with delayed onset of pancreatic insufficiency carry a second cystic fibrosis transmembrane conductance regulator gene mutation on one allele. [Abstract] Am. J. Hum. Genet. 53: 83.

29 Struewing,J.P., Abeliovich,D., Peretz, T., Avishai,N., Kaback,M.M., Collins,F.S. and Brody,L.C. (1995) The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals. Nature Genet. 11: 198-200. MEDLINE Abstract

30 Reynolds, J.E., Meyer, J.M., Landa, B., Stevens, C.A., Arnos, K.S., Israel, J., Marazita, M.L., Bodurtha, J., Nance, W.E. and Diehl, S.R. (1995) Analysis of variability of clinical manifestations in Waardenburg syndrome. Am. J. Med. Genet. 57:540-547. MEDLINE Abstract

31 Waardenburg, P.J., Franceschetti, A. and Klein, D. (1961) Lacrimal apparatus.In: Charles C. Thomas, IV, Genetics and Ophthalmology, pp. 291-300.

32 Hoeve, J.V.D. (1916) Abnorme Lange der Tranenrorhrchen mit Ankyloblepharon. Klin. Mbl. Augenheilk. 56:232.

33 Lavergne, G. (1960) Problemes d'eugenisme poses par une famille atteinte de syndrome de Waardenburg-Klein. Soc. belge. Ophtal. 193:181.

34 Puffenberger, E.G., Kauffman, E.R., Bolk, S., Matise, T.C., Washington, S.S., Augrist, M., Weissenbach, J., Garver, K., Mascari, M., Ladda, R., Slangenhaupt, S.A. and Chakravart, A. (1994) Identity by descent and association mapping of a recessive gene for Hirschsprung disease on chromosome 13q22. Hum. Mol. Genet. 3:1217-1225. MEDLINE Abstract

35 Paven, W.J., Mac, S., Cheng, M. and Tilghman, S.M. (1995) Quantitative trait loci that modify the severity of spotting in piebald mice. Genome Res. 5:29-41.

36 Tripathi, R.K., Droetto, S. and Spritz, R.A. (1992) Many patients with `tyrosinase positive' ocalocutaneous albinism have tyrosinase gene mutations. Am. J. Hum. Genet. 51:179.

37 Bell, G.I., Karam, J.H. and Rutter, W.J. (1981) Polymorphic DNA region adjacent to the 5' end of the human insulin gene. Proc. Natl Acad. Sci. USA 78:5759-5763. MEDLINE Abstract

38 Thein, S.L. (1995) The use of synthetic oligonucleotides as specific hybridization probes in the diagnosis of genetic disorders. In: Davies, K.E. ed. Human Genetic Disease Analysis: A practical approach,2nd ed. Oxford: IRL Press, pp. 21-33.


*To whom correspondence should be addressed


This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:07 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pandya, A.
Right arrow Articles by Nance, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandya, A.
Right arrow Articles by Nance, W. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?