cDNA cloning of a human homologue of the Caenorhabditis elegans cell fate-determining gene mab-21: expression, chromosomal localization and analysis of a highly polymorphic (CAG)n trinucleotide repeat
cDNA cloning of a human homologue of the Caenorhabditis elegans cell fate-determining gene mab -21: expression, chromosomal localization and analysis of a highly polymorphic (CAG) n trinucleotide repeatRussell L. Margolis1,*, O. Colin Stine2, Melvin G. McInnis2, Neal G. Ranen1, David C. Rubinsztein10, Jayne Leggo10, Lorraine V. Jones Brando3, Arif S. Kidwai1, Scott J. Loev1, Theresa S. Breschel2, Colleen Callahan2, Sylvia G. Simpson2, J.Raymond DePaulo2, Francis J. McMahon2, Sanjeev Jain11, Eugene S. Paykel11, Cathy Walsh11, Lynn E. DeLisi12, Timothy J. Crow13, E. Fuller Torrey14, Roxann G. Ashworth4, Jennifer P. Macke5,6,7, Jeremy Nathans5,6,7,8 and Christopher A. Ross1,7,9,*
1Laboratory of Molecular Neurobiology, Department of Psychiatry, 2Division of Psychiatric Genetics, Department of Psychiatry, 3Division of Pediatric Infectious Diseases, 4Department of Medical Genetics, 5Department of Molecular Biology and Genetics, 6Howard Hughes Medical Institute, 7Department of Neuroscience, 8Department of Ophthalmology and 9Program in Cellular and Molecular Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205-2196, USA, 10East Anglian Regional Genetics Service Molecular Genetics Laboratory and 11University of Cambridge, Department of Psychiatry, Addenbrooke's Hospital, Cambridge CB2 2QQ, UK, 12Department of Psychiatry and Behavioral Science, State University of New York at Stony Brook, New York, NY 11794-8101, USA, 13Department of Psychiatry, University of Oxford, Warneford Hospital, Oxford OX3 7JX, UK and 14National Institute of Mental Health Neurosciences Center at St. Elizabeths, Washington, DC 20032, USA
Received December 4, 1995;Revised and Accepted February 8, 1996GenBank accession no. U38810
The two most consistent features of the diseases caused by trinucleotide repeat expansion-neuropsychiatric symptoms and the phenomenon of genetic anticipation-may be present in forms of dementia, hereditary ataxia, Parkinsonism, bipolar affective disorder, schizophrenia and autism. To identify candidate genes for these disorders, we have screened human brain cDNA libraries for the presence of gene fragments containing polymorphic trinucleotide repeats. Here we report the cDNA cloning of CAGR1, originally detected in a retinal cDNA library. The 2743 bp cDNA contains a 1077 bp open reading frame encoding 359 amino acids. This amino acid sequence is homologous (56% amino acid identity and 81% amino acid conservation) to the Caenorhabditis elegans cell fate-determining protein mab-21. CAGR1 is expressed in several human tissues, most prominently in the cerebellum, as a message of ~3.0 kb. The gene was mapped to 13q13, just telomeric to D13S220. A 5'-untranslated CAG trinucleotide repeat is highly polymorphic, with repeat length ranging from six to 31 triplets and a heterozygosity of 87-88% in 684 chromosomes from several human populations. One allele from an individual with an atypical movement disorder and bipolar affective disorder type II contains 46 triplets, 15 triplets longer than any other allele detected. Though insufficient data are available to link the long repeat to this clinical phenotype, an expansion mutation of the CAGR1 repeat can be considered a candidate for the etiology of disorders with anticipation or developmental abnormalities, and particularly any such disorders linked to chromosome 13.
Trinucleotide repeat expansion mutation, also known as dynamic mutation, is now known to cause nine human diseases (1 -4 ). In the Type I diseases, X-linked spinal and bulbar muscular atrophy (SBMA or Kennedy's disease) (5 ), Huntington's disease (HD) (6 ), spinocerebellar atrophy type 1 (SCA1) (7 ), dentatorubral and pallidoluysian atrophy (DRPLA) (8 -10 ) and Machado-Joseph disease (SCA III) (11 ), a CAG repeat encoding glutamine expands from a normal range of ~10-35 repeats to >35-40 repeats. These diseases are characterized by neurodegeneration, with typical disease onset in middle age. The androgen receptor, in which a CAG expansion causes SBMA, is a zinc finger domain transcription factor (12 ). The normal function of the proteins encoded by the genes associated with the other four disorders is unknown and the proteins share no sequence homology other than the glutamine repeat. The mechanism by which repeat expansion causes these diseases is also unknown, though a variety of evidence suggests that an excessively long glutamine repeat leads to a toxic gain-of-function (13 -19 ).
The Type II repeat expansion mutation diseases include myotonic dystrophy (MD) (20 -22 ), the A (23 -25 ) and E (26 ) forms of fragile X syndrome (FraXA and FraXE) and some forms of Jacobsen syndrome (27 ). These diseases are characterized by CGG or CTG repeat expansions in untranslated regions. Normal repeat length in the associated genes ranges from five or six to ~25 (FraXE), 37 (MD) and 42 (FraXA), though in the Jacobsen syndrome (CBL2) normal repeat length is limited to 11-14 repeats. Expansion beyond 200 repeats in Fragile X and 50-60 repeats in MD and Jacobsen syndrome (the latter through chromosomal deletion) leads to disease. Alleles intermediate between normal and disease length, termed premutations, are unstable in transmission but do not lead to a disease phenotype. The normal functions of the genes associated with the Type II diseases (except FraXE) are now at least partially understood. The FMR gene product (involved in FraXA) is believed to be an RNA binding protein associated with ribosomes (28 -30 ). MDK (myotonic dystrophy) is a protein kinase (31 ) and CBL2 (Jacobsen syndrome) is a proto-oncogene with a role in a receptor tyrosine kinase signal transduction pathway (32 ,33 ). In fragile X and myotonic dystrophy, the abnormal repeat reduces or eliminates normal transcription of the associated mRNA, or causes other RNA abnormalities (4 ). In Jacobsen's syndrome, the repeat expansion leads to a deletion of a portion of chromosome 11 (27 ).
Type I and Type II diseases share the phenomenon of genetic anticipation, in which symptom severity worsens or age of onset decreases in successive generations (though in Jacobsen syndrome, genotype but not phenotype becomes more abnormal). In addition, the pathology of each disease includes neurodegeneration or neurodevelopmental abnormalities. Other diseases that share these features, and that may therefore also stem from repeat expansion, include various forms of hereditary dementia, ataxia, Parkinsonism, spinocerebellar atrophy, bipolar affective disorder, autism and schizophrenia (34 -40 ). To establish candidate genes for these disorders, we and others have sought to identify and map cDNA fragments with polymorphic trinucleotide repeats expressed in the human brain (8 ,41 -46 ). As part of this effort, we now report a cDNA sequence mapping to 13q13 that encodes a peptide homologous to the Caenorhabditis elegans protein mab-21 and contains a highly polymorphic 5'-untranslated CAG repeat.
Clone CAGJM, containing a (CAG)21 trinucleotide repeat, was serendipitously isolated by random sequencing of a human retina cDNA library as part of a search for novel genes expressed in the retina [(47 ); J.P.M. and J.N., unpublished; see Materials and Methods]. The complete coding region of the cDNA containing this repeat (termed CAGR1) was obtained by isolating three additional clones from human cerebellar and cortical cDNA libraries, two of which span the entire open reading frame (Fig. 1 ). The consensus 2750 bp [excluding the poly(A) tail] cDNA nucleotide sequence, derived from double-stranded sequence of each clone, is displayed in Figure 2 . The only discrepancy in sequence among the clones occurred at the 5' end of the original retinal library clone (CAGJM) at base pairs 383-424. The alternate sequence, 5'CGATCAAATGGAGGAAAAGTGTGCTGAGTGTGTGTCCGGGGT3', may represent a cloning artifact or an alternate splice site. The CAG (alternatively, AGC or GCA) trinucleotide repeat begins at base pair 598.
CAGR1, initially identified from a retinal cDNA library, encodes a 359 amino acid sequence homologous (56% identical and 81% conserved amino acids) to the C.elegans cell fate-determining protein mab-21. CAGR1 is located on chromosome 13q13, telomeric to marker D13S220, and is expressed most highly in the brain, particularly the cerebellum. A 5'-untranslated CAG trinucleotide repeat is highly polymorphic, ranging from six to 31 triplets in length in several populations, with one allele of 46 repeats detected in an individual with an idiopathic movement disorder and an affective disorder.
The primary clue concerning the function of CAGR1 is its homology to mab-21. mab-21 was first defined as a mutation resulting in abnormal development of one set of the nine pairs of peripheral sense organs, known as rays, found in the posterior of the male C.elegans (51 ). In mab-21 mutants, ray 6 is absent and ray 4 is replaced by a larger fusion ray. A neural cell and a glia-like cell normally found in ray 6 assume the characteristics of homologous cells in ray 4, a ray 6 hypodermal cell fuses to the wrong partner cell, and another hypodermal cell develops into a neuroblast (52 ). These abnormalities in the ray structure of the tail, and less fully characterized abnormalities of morphology, movement and reproduction, suggest that mab-21 acts to specify cell fate. mab-21 may act downstream from the HOM-C/Hox set of transcription factor genes, which regulate pattern formation on a global scale, to regulate cell fate on a local level (52 ). It is possible that CAGR1 has a similar role; the pattern of CAGR1 expression suggests that the cerebellum is a site of CAGR1 action.
A number of human diseases arise from mutations in homologues to genes that regulate development in other species. For instance, translocations within a human homologue of the Drosophila notch gene, TAN1 (translocation-associated notch homolog), result in acute T-cell lymphoblastic leukemia (53 ). It has been suggested that TAN1 may play a role in cell fate determination during hematopoiesis (54 ). PAX3, a member of the family of `paired-box' genes first identified as regulators of Drosophila segmentation, encodes a DNA binding protein important in early neurogenesis (55 ). A point mutation in PAX3 leads to the mouse phenotype splotch, characterized by pigmentary abnormalities, spina bifida and exencephaly (56 ). In humans, the Waardenburg syndrome, characterized by facial dysmorphia, pigmentary disturbance, and cochlear deafness (MIM 193500), arises from any one of a variety of mutations within HUP2, the human homolog of PAX3 (57 ). PAX6, another member of the paired-box gene family, is critical to eye development in Drosophila, mice and humans (58 ). Mutations in human PAX6 result in aniridia (59 , 60 ), other anterior segment malformations (61 ) and a form of keratitis (62 ). A neonate with each PAX6 allele affected by a different nonsense mutation had no eyes and severe craniofacial and central nervous system abnormalities, similar to the phenotype observed in mice homozygous for a PAX6 mutation (63 ). Mutations within the EMX2 homeobox gene, the human cognate of a gene expressed in proliferating neuroblasts of the developing mouse cerebral cortex, have recently been associated with schizencephaly, a disorder characterized by large clefts of the cerebral hemisphere (64 ).
At least one disorder with developmental abnormalities, the Moebius syndrome, has been mapped to a location near CAGR1. Narrowly defined, the clinical features of this syndrome include 6th and 7th cranial nerve palsies and various skeletal defects, but numerous variations have been reported in >200 cases (65 ). In seven individuals from one family, congenital 7th nerve palsy and digital contractures were associated with a 1p34:13q13 translocation (66 ). An isolated case of Moebius syndrome associated with deletion of 13q12.2 has also been reported (67 ), suggesting that mutations at a locus on 13q may be sufficient to cause at least some forms of the disorder. The location of CAGR1 raises the possibility that a mutation within this gene could be present in some of the reported cases. Interestingly, fragile site Fra13A has been mapped to a region near CAGR1, though at present there is no evidence implicating a CAG/CTG repeat in fragile site induction (27 ,68 ).
The normal allele distribution of CAGR1 appears to range from six to 31 triplets. African and and non-African populations have somewhat different allele distributions; most notably, the modal repeat length (13 triplets) in all non-African populations is present three times more frequently than the next most common allele, whereas no dominant modal length is present in the African population. This difference is consistent with previous findings that microsatellite allelic diversity in Africans exceeds that of other populations (69 ). The generally shorter and less polymorphic CAGR1 repeats observed in non-human primates compared with humans is also consistent with a previous comparison of di-, tri- and tetranucleotide repeat length in primates (70 ); humans typically have longer repeats, suggesting that repeat length evolution is directional and occurs at variable rates in different species.
The extent of CAGR1 repeat polymorphism is strikingly similar to that seen in the repeats that expand to cause disease. CAGR1 resembles the genes associated with Type II disorders (FMR, CBL2 and MDK) since the repeat is not within a coding region of the gene. The analogy to these genes suggests that repeats with more than ~40 or 50 triplets may be meiotically unstable (premutations), while biochemical and perhaps phenotypic abnormalities may result with repeat lengths in the range of 100-200 triplets (2 ,5 ). This makes the finding of one allele with a repeat length of 46, 15 triplets longer than the other 683 alleles tested, particularly provocative. Whether a relationship exists between the phenotype of the individual involved (an atypical movement disorder accompanied by bipolar affective disorder type II) and the repeat is impossible to ascertain at present. The long repeat may represent a rare normal variant or a premutation. Thus far, no other alleles with unusually long repeats have been detected in subjects with schizophrenia, affective disorder or a movement disorder. Nonetheless, expansion of the CAGR1 repeat remains an attractive candidate for the etiology of disorders with features of anticipation or developmental abnormalities, and particularly any such disorders linked to chromosome 13q.
CAGJM, a clone with a short insert containing a (CAG)21 trinucleotide repeat, was identified as part of a search for novel genes expressed in the retina [(47 ); J.P.M. and J.N., unpublished]. The search strategy involved isolating inserts from a human retinal cDNA library en masse by EcoRI cleavage and preparative gel electrophoresis. Inserts were then used as a template for DNA synthesis using the Klenow Escherichia coli polymerase I fragment and the primer 5'GACGAGATATTAGAATTCTACTCGNNNNNN3' (N = a combination of all four bases). After heat denaturation and a second cycle of priming, the primer 5'CCCCCCCCCGACGAGATATTAGAATTCTACTC3' was used for PCR amplification of those inserts with the original primer incorporated into both ends. After EcoRI cleavage, isolation of 400-600 bp inserts, and recloning into [lambda]gt10, the library was plated at low density, and screened to eliminate repetitive or mitochondrial sequences. After PCR with primers flanking the [lambda]gt10 insertion sites, the products were sequenced (ABI, performed by Johns Hopkins Core Genetics Facility).
CAGJM was subcloned into pCRII using the TA cloning method (Invitrogen). An oligonucleotide (CAGR1.45: 5'GAATCCTTGTGTGAGAGAACCGCATGGAGAGATCACCTTCTCGG3') flanking the repeat was used to screen human cerebellar and cerebral cortex libraries (Stratagene) using standard methods (71 ) as we have previously described (8 ). Libraries were plated at a density of ~20 000-50 000 plaques per 150 mm plate. Duplicate supported nitrocellulose filters from each plate were lifted, denatured, neutralized, baked at 80oC and briefly washed in 2* SSC. Filters were then prehybridized in 50% formamide, 5* SSPE, 5* Denhardt's solution (0.1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 10 mg/ml denatured salmon sperm DNA, and 0.5% SDS for at least 1 h. Probes were labelled with [[gamma]-32P]ATP using polynucleotide kinase (New England Biolabs). Hybridization was in the same buffer for 38 h at 42oC. Filters were washed in 2* SSC and 0.5% SDS at 25oC for 30 min and then in 0.2* SSC/0.5% SDS at 56oC for 30 min. After an overnight exposure, positive plaques were selected and plaque purified. Plasmids (pBluescript SK) were excised using an in vivo excision procedure (Stratagene). Clones were fully sequenced on both strands using an ABI automated sequencing apparatus. Additional sequencing, with unique primers, was performed in the region surrounding the repeat to confirm the open reading frame. After clone alignment and determination of a final cDNA sequence using the application SequencherT (Gene Codes Corp.), a search for homologies to the nucleotide and conceptually translated amino acid sequences was performed against GenBank using blastn, blastp, blastx (72 ), BEAUTY (73 ) and BLOCKS (74 ). Hydrophilicity of the amino acid sequence was analysed using the Kyte-Doolittle scale as performed by the application MacVectorT (Eastman Kodak). The complete cDNA construction was termed CAGR1 (CAG repeat detected in a retinal library).
To detect repeat length variation in CAGR1, PCR was performed across the repeat region, using primers flanking the repeat (CAGJM-5'-1: 5'GATAAAAGGAAGGGAAAA3', CAGJM-3'-1: 5'CAGAAATGGATCAAAAAT3') and genomic DNA as templates. The East Anglian samples were from patients referred for testing of an HD expansion; the population is primarily of Northern European ancestry. The African samples were from patients with sickle cell anaemia, primarily from Nigeria (70 ). DNA from individuals with schizophrenia and bipolar disorder was obtained from several sources: (i) probands with Diagnostic and Statistical Manual-III-Revised (DSM-III-R) (75 ) defined schizophrenia [using a modified Schedule for Affective Disorders and Schizophrenia interview (76 ) and multiple external sources of information] and a least one sib with either schizophrenia or schizoaffective disorder who were recruited from the United States, Great Britain and Italy as previously described (77 ); (ii) probands with bipolar affective disorder, type I as defined by Research Diagnostic Criteria (RDC) (78 ) who were recruited from the clinics of an East Anglian hospital; (iii) probands with RDC-defined bipolar type I who have been entered in the Johns Hopkins Bipolar Genetic Linkage Study as previously described (35 ); (iv) tissue samples from the brain collection of the Stanley Foundation at St. Elizabeth's Hospital, Washington, DC (post-mortem diagnosis of affective disorder or schizophrenia by DSM-III-R criteria), obtained and prepared as previously described (79 ). CAGR1 repeat length was also tested in DNA from patients referred to Johns Hopkins or Cambridge for assessment of idiopathic movement disorders similar to those seen in the known trinucleotide repeat expansion diseases, but who did not have any of the known expansions. Repeat length was also assesed in DNA from 84 unrelated individuals obtained from the Centre d'Etude du Polymorphisme Humain (CEPH) collaborative.
PCR employed 40-100 ng of genomic DNA, 400 pM of each unlabelled primer, ~40 pM of CAGJM 3'-1 radiolabelled with [[gamma]-32P]ATP, 200 [mu]M dNTP, 1.5 mM MgCl2, and 0.2 units of Taq polymerase (Boehringer Mannheim) in a total reaction volume of 12.5 [mu]l. After denaturation at 96oC for 2 min, the reaction consisted of 33 cycles of 96oC for 30 s, 52oC for 30 s and 72oC for 60 s, followed by a 7 min extension at 72oC. Product size was determined by electrophoresis on a 6% denaturing polyacryl- amide-urea gel, and comparison with size markers and clones of known repeat length. Alternatively, primers were fluorescently labelled and product size measured on an ABI sequencing apparatus.
CAGR1 chromosomal location was determined by three independent methods. First, Panel 2 of DNA from NIGMS monochromosomal human-rodent hybrid cell lines was used as PCR template (80 ) to indicate that CAGR1 is located on chromosome 13. More precise localization was obtained by PCR using genomic DNA from CEPH families in which polymorphic markers have been mapped (81 ). Two-point linkage analysis was performed using the LINKAGET program (82 ) between CAGR1 repeat length and known polymorphic loci on chromosome 13 in families 1331, 1362, 1413 and 884. For further definition of location, CAGR1 was mapped relative to loci D13S220 and D13S267 using a radiation hybrid panel (83 ).
Northern blots of total RNA derived from human brain tissue by the CsCl method or purchased (Clontech) were probed with an antisense oligonucleotide (5'TGCTTTTCCCTTCCTTTTATCTTTGAGCCCAGCCGTTCT3') at a hybridization temperature of 42oC in the buffer described above modified to include 10* Denhardt's solution and 2% SDS. The multiple tissue blot was washed at room temperature for 30 min with 2* SSC/0.05% SDS and then at 50oC for 30 min with 0.1* SSC/0.1% SDS. The brain region blot was washed at room temperature for 30 min with 2* SSC/0.5% SDS and then at 56oC for 30 min with 0.2* SSC/0.5% SDS. The blots were exposed to a phosphor screen for 24-72 h (Molecular Dynamics) and digitally composed. The multiple brain region experiment was performed three times and the multiple tissue experiment was performed twice with similar results. No signal was detected on blots probed with the reverse complement of the antisense probe. Blots were subsequently probed with an oligonucleotide specific to GAPDH (5'GCCCACAGCCTTGGCAGCACCAGTGGATGCAGGGATGATGTTCCTG3') to control for the amount of RNA loading in each lane.
The authors are grateful to the Stanley Foundation for access to tissue from the Stanley Foundation at St. Elizabeth's Hospital, Washington, DC. The authors would also like to acknowledge the assistance of Dr Wha Young Lee (Research Genetics, Inc.) for radiation hybrid mapping, Drs Farhat Khan and Shi-Hua Li for technical assistance and advice, Drs Scott Emmons and King Chow for information concerning mab-21 and Duane Bartley, Betsy Nanthakumar and Dr Alan Scott for assistance with DNA sequencing. This work was conducted with support for R.L.M. from a Johns Hopkins Clinician Scientist Award, a NARSAD Young Investigator Award, and NIMH MH02175-10A1; a Stanley Foundation Award, Scottish Rite Schizophrenia Foundation Award, NARSAD Established Investigator Award, NIMH MH 50763, NINDS NS34172 and NINDS NS16375 to C.A.R.; the DeVelbiss fund for Alzheimer's Research; and the Huntington's Disease Association (UK) to D.C.R.
2 Sutherland, G.R. and Richards, R.I. (1995) Simple tandem DNA repeats and human genetic disease. Proc. Natl Acad. Sci. USA, 92, 3636-3641.MEDLINE Abstract
3 Ross, C.A., McInnis, M.G., Margolis, R.L. and Li, S.-H. (1993) Genes with triplet repeats: candidate mediators of neuropsychiatric disorders. Trend Neurosci., 16, 254-260.MEDLINE Abstract
4 La Spada, A.R., Paulson, H.L. and Fischbeck, K.H. (1994) Trinucleotide repeat expansion in neurological disease. Ann. Neurol., 36, 814-822.MEDLINE Abstract
5 La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. and Fischbeck, K.H. (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 77-79.MEDLINE Abstract
6 The Huntington's Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell, 72, 971-983.
7 Orr, H.T., Chung, M.-y., Banfi, S., Kwiatkowski, T.J., Servadio, A., Beaudet, A.L., McCall, A.E., Duvick, L.A., Ranum, L.P.W. and Zoghbi, H.Y. (1993) Expansion of an unstable trinucleotide repeat in spinocerebellar ataxia type 1. Nature Genet., 4, 221-226.MEDLINE Abstract
8 Li, S.-H., McInnis, M.G., Margolis, R.L., Antonarakis, S.E. and Ross, C.A. (1993) Novel triplet repeat containing genes in human brain: cloning, expression, and length polymorphisms. Genomics, 16, 572-579.MEDLINE Abstract
9 Koide, R., Ikeuchi, T., Onodera, O., Tanaka, H., Igarashi, S., Endo, K., Takahashi, H., Kondo, R., Ishikawa, A., Hayashi, T., Saito, M., Tomoda, A., Miike, T., Naito, H., Ikuta, F. and Tsuji, S. (1994) Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nature Genet., 6, 9-12.MEDLINE Abstract
10 Nagafuchi, S., Yanagisawa, H., Sato, K., Shirayama, T., Ohsaki, E., Bundo, M., Takeda, T., Tadokoro, K., Kondo, I., Murayama, N., Tanaka, Y., Kikushima, H., Umino, K., Kurosawa, H., Furukawa, T., Nihei, K., Inoue, T., Sano, A., Osamu, K., Takahashi, M., Yoshizawa, T., Kanazawa, I. and Yamada, M. (1994) Expansion of an unstable CAG trinucleotide on chromosome 12p in dentatorubral and pallidoluysian atrophy. Nature Genet., 6, 14-17.MEDLINE Abstract
11 Kawaguchi, Y., Okamoto, T., Taniwaki, T., Aizawa, M., Inoue, M., Katayama, S., Kawakami, H., Nakamura, S., Nishimura, M., Akiguchi, I., Kimura, J., Narumiya, S. and Kakizuka, A. (1994) CAG expansions in a novel gene for Machado-Joseph disease at chromosome 14q32.1. Nature Genet., 8, 221-228.MEDLINE Abstract
12 Tilley, W.D., Marcelli, M., Wilson, J.D. and McPhaul, M.J. (1989) Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl Acad. Sci. USA, 86, 327-331.MEDLINE Abstract
13 Ross, C.A. (1995) When more is less: pathogenesis of glutamine repeat neurodegenerative diseases. Neuron, 15, 493-496.MEDLINE Abstract
14 Li, X.-J., Li, S.-H., Sharp, A.H., Nucifora Jr., F.C., Schilling, G., Lanahan, A., Worley, P., Snyder, S.H. and Ross, C.A. (1995) A huntingtin-associated protein enriched in brain with implications for pathology. Nature, 378, 398-402.MEDLINE Abstract
15 Perutz, M.F., Johnson, T., Suzuki, M. and Finch, J.T. (1994) Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases. Proc. Natl Acad. Sci. USA, 91, 5355-5358.MEDLINE Abstract
16 Schilling, G., Sharp, A.H., Loev, S.J., Wagster, M.V., Li, S.-H., Stine, O.C. and Ross, C.A. (1995) Expression of the Huntington's disease (IT15) protein product in HD patients. Hum. Mol. Genet., 4, 1365-1371.MEDLINE Abstract
17 Green, H. (1993) Human genetic diseases due to codon reiteration: relationship to an evolutionary mechanism. Cell, 74, 955-956.MEDLINE Abstract
18 Orr, H.T. and Clark, H.B. (1995) Genetic approaches to pathogenesis of neurodegenerative diseases. Lab. Invest., 73, 161-171.MEDLINE Abstract
20 Brook, J.D., McCurrach, M.E., Harley, H.G., Buckler, A.J., Church, D., Aburatani, H., Hunter, K., Davies, J., Shelbourne, P., Buxton, J., Jones, C., Juvonen, V., Johnson, K., Harper, P.S., Shaw, D.J. and Housman, D.E. (1992) Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell, 68, 799-808.MEDLINE Abstract
21 Fu, Y.-H., Pizzuti, A., Fenwick, R.G., King, J., Rajnarayan, S., Dunne, P.W., Dubel, J., Nasser, G.A., Ashizawa, T., De Jong, P., Wieringa, B., Korneluk, R., Perryman, M.B., Epstein, H.F. and Caskey, C.T. (1992) An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science, 255, 1256-1258.MEDLINE Abstract
22 Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., Jansen, G., Nelville, C., Narang, M., Barcelo, J., O'Hoy, K., Leblond, S., Earle-MacDonald, J., DeJong, P.J., Wieringa, B. and Korneluk, R.G. (1992) Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science, 255, 1253-1255.MEDLINE Abstract
23 Fu, Y.-H., Kuhl, D.P.A., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, S., Verkerk, A.J.M.H., Holden, J.J.A., Fenmwick, R.G., Warren, S.T., Oostra, B.A., Nelson, D.L. and Caskey, C.T. (1991) Variation of the CGG repeat at the Fragile X site results in genetic instability: resolution of the Sherman paradox. Cell, 67, 1047-1058.MEDLINE Abstract
24 Kremer, E.J., Pritchard, M., Lynch, M., Yu, S., Holman, K., Baker, E., Warren, S.T., Schlessinger, D., Sutherland, G.R. and Richards, R.I. (1991) Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CCG)n. Science, 252, 1711-1714.MEDLINE Abstract
25 Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.-H., Kuhl, D.P.A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F., Eussen, B.E., van Ommen, G.-J.B., Blonden, L.A.J., Riggins, G.J., Chastain, J.L., Kunst, C.B., Galjaard, H., Caskey, C.T., Nelson, D.L., Oostra, B.A. and Warren, S.T. (1991) Identification of a gene (FMR-1) containing CGG repeat coincident with a breakpoint cluster region exhibiting length variation in Fragile X syndrome. Cell, 65, 905-914.
26 Knight, S.J.L., Flannery, A.V., Hirst, M.C., Campbell, L., Christodoulou, Z., Phelps, S.R., Pointon, J., Middletonprice, H.R., Barnicoat, A., Pembrey, M.E., Holland, J., Oostra, B.A., Bobrow, M. and Davies, K.E. (1993) Trinucleotide repeat amplification and hypermethylation of a CpG island in FRAXE mental retardation. Cell, 74, 127-134.
27 Jones, C., Penny, L., Mattina, T., Yu, S., Baker, E., Voullaire, L., Langdon, W.Y., Sutherland, G.R., Richards, R.I. and Tunnacliffe, A. (1995) Association of a chromosome deletion syndrome with a fragile site with the proto-oncogene CBL2. Nature, 376, 145-149.MEDLINE Abstract
28 Ashley, C.T., Wilkinson, K.D., Reines, D. and Warren, S.T. (1993) FMR-1 protein: conserved RNP family domains and selective RNA binding. Science, 262, 563-566.MEDLINE Abstract
29 Verheij, C., Bakker, C.E., de Graaff, E., Keulemans, J., Willemsen, R., Verkerk, A.J., Galjaard, H., Reuser, A.J., Hoogeveen, A.T. and Oostra, B.A. (1993) Characterization and localization of the FMR-1 gene product associated with fragile X syndrome. Nature, 363, 722-724.MEDLINE Abstract
30 Siomi, H., Siomi, M.C., Nussbaum, R.L. and Dreyfuss, G. (1993) The protein product of the fragile X gene, FMR-1, has characteristics of an RNA binding protein. Cell, 74, 291-298.MEDLINE Abstract
31 Etongue-Mayer, P., Faure, R., Bouchard, J.P., Thibault, M.C. and Puymirat, J. (1994) The myotonin-protein kinase phosphorylates tyrosine residues in normal human skeletal muscle. Biochem. Biophys. Res. Commun., 199, 89-92.MEDLINE Abstract
32 Andoniou, C.E., Thien, C.B. and Langdon, W.Y. (1994) Tumour induction by activated abl involves tyrosine phosphorylation of the product of the cbl oncogene. EMBO J., 13, 4515-4523.MEDLINE Abstract
33 Donovan, J.A., Wange, R.L., Langdon, W.Y. and Samelson, L.E. (1994) The protein product of the c-cbl protooncogene is the 120-kDa tyrosine-phosphorylated protein in Jurkat cells activated via the T cell antigen receptor. J. Biol. Chem., 269, 22921-22924.MEDLINE Abstract
34 Ross, C.A., McInnis, M.G., Margolis, R.L. and Li, S.-H. (1993) Genes with triplet repeats: candidate mediators of neuropsychiatric disorders. Trend Neurosci., 16, 254-260.MEDLINE Abstract
35 McInnis, M.G., McMahon, F.J., Chase, G.A., Simpson, S.G., Ross, C.A. and DePaulo, J.R. (1993) Anticipation in bipolar affective disorder. Am. J. Hum. Genet., 53, 385-390.MEDLINE Abstract
36 Petronis, A. and Kennedy, J.L. (1995) Unstable genes-unstable mind? Am. J. Psychiatr., 152, 164-172.MEDLINE Abstract
37 Stine, O.C. (1993) Is autism associated with an X-linked trinucleotide repeat? Psychiatr. Genet., 3, 129.
38 O'Donovan, M.C., Guy, C., Craddock, N., Murphy, K.C., Cardno, A.G., Jones, L.A., Owen, M.J. and McGuffin, P. (1995) Expanded CAG repeats in schizophrenia and bipolar disorder. Nature Genet., 10, 380-381.MEDLINE Abstract
39 Schalling, M., Hudson, T.J., Buetow, K.H. and Housman, D.E. (1993) Direct detection of novel expanded trinucleotide repeats in the human genome. Nature Genet., 4, 135-139.MEDLINE Abstract
40 Bassett, A.S. and Honer, W.G. (1994) Evidence for anticipation in schizophrenia. Am. J. Hum. Genet., 54, 864-870.MEDLINE Abstract
42 Tsuji, S., Igarashi, S., Takiyama, Y., Onodera, O. and Tanaka, H. (1995) Isolation and characterization of human cDNA clones containing polymorphic CAG trinucleotide repeats from human cerebellum, fetal brain, striatum, and nigra cDNA libraries. Am. J. Hum. Genet., 57, A152.
43 Jiang, J.-X., Deprez, R.H.L., Zwarthoff, E.C. and Riegman, P.H.J. (1995) Characterization of four novel CAG repeat-containing clones. Genomics, 30, 91-93.MEDLINE Abstract
44 Margolis, R.L., Breschel, T.S., Li, S.-H., Kidwai, A.S., McInnis, M.G. and Ross, C.A. (1995) Polymorphic (AAT)n trinucleotide repeats derived from a human brain cDNA library. Hum. Genet., 495-496.MEDLINE Abstract
45 Margolis, R.L., Breschel, T.S., Li, S.-H., Kidwai, A.S., Antonarakis, S.E., McInnis, M.G. and Ross, C.A. (1995) Identification and characterization of cDNA clones containing CCA trinucleotide repeats derived from human brain. Som. Cell Mol. Genet., in press. MEDLINE Abstract
46 Gastier, J.M., Pulido, J.C., Sunden, S., Brody, T., Buetow, K.H., Murray, J.C., Weber, J.L., Hudson, T.J., Sheffield, V. and Duyk, G.M. (1995) Survey of trinucleotide repeats in the human genome-assessment of their utility as genetic markers. Hum. Mol. Genet., 4, 1829-1836.MEDLINE Abstract
47 Nathans, J., Thomas, D. and Hogness, D.S. (1986) Molecular genetics of human color vision: the genes encoding blue, green, and red pigments. Science, 232, 193-202.MEDLINE Abstract
48 Telenius, H., Kremer, H.P.H., Theilmann, J., Andrew, S.E., Almqvist, E., Anvret, M., Greenberg, C., Greenberg, J., Lucotte, G., Squitieri, F., Starr, E., Goldberg, Y.P. and Hayden, M.R. (1993) Molecular analysis of juvenile Huntington disease: the major influence on (CAG)n repeat length is the sex of the affected parent. Hum. Mol. Genet., 2, 1535-1540.MEDLINE Abstract
49 Stine, O.C., Pleasant, N., Wagster, M.V., Kasch, L., Hedreen, J. and Ross, C.A. (1994) Somatic instability of the expanded allele of IT-15 from patients with Huntington disease. Am. J. Hum. Genet., 55, A244.
50 Takano, H., Onodera, O., Takahashi, H., Igarashi, S., Yamada, M., Oyake, M., Ikeuchi, T., Koide, R., Tanaka, H., Iwabuchi, K. and Tsuji, S. (1995) Somatic mosaicism of the CAG repeat expansion in the central nervous system as a reflection of progressive neuronal cell loss in dentatorubral-pallidoluysian atrophy. Am. J. Hum. Genet., 57, A9.
51 Baird, S.E., Fitch, D.H.A., Kasem, I.A.A. and Emmons, S.W. (1991) Pattern formation in the nematode epidermis: determination of the arrangement of peripheral sense organs in the C.elegans male tail. Development, 113, 515-526.MEDLINE Abstract
52 Chow, K.L., Hall, D. and Emmons, S.W. (1995) The mab-21 gene of Caenorhabditis elegans encodes a novel protein required for choice of alternate cell fates. Development, 121, 3615-3626.MEDLINE Abstract
53 Ellisen, L.W., Bird, J., West, D.C., Soreng, A.L., Reynolds, T.C., Smith, S.D. and Sklar, J. (1991) TAN-1, the human homolog of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 66, 649-661.MEDLINE Abstract
54 Milner, L.A., Kopan, R., Martin, D.I.K. and Berstein, I.D. (1994) A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors. Blood, 83, 2057-2062.MEDLINE Abstract
55 Goulding, M.D., Chalepakis, G., Deutsch, U., Erselius, J.R. and Gruss, P. (1991) Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J., 10, 1135-1147.MEDLINE Abstract
56 Epstein, D.J., Vekemans, M. and Gros, P. (1991) Splotch (Sp-2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3. Cell, 67, 767-774.MEDLINE Abstract
57 Baldwin, C.T., Hoth, C.F., Macina, R.A. and Milunsky, A. (1995) Mutations in PAX3 that cause Waardenburg syndrome type I: ten new mutations and review of the literature. Am. J. Med. Genet., 58, 115-122.MEDLINE Abstract
58 Hanson, I. and Van Heyningen, V. (1995) Pax6: more than meets the eye. Trends Genet., 11, 268-272.MEDLINE Abstract
59 Ton, C.C.T., Hirvonen, H., Miwa, H., Weil, M.M., Monaghan, P., Jordan, T., van Heyningen, V., Hastie, N.D., Meijers-Heijboer, H., Drechsler, M., Royer-Pokora, B., Collins, F., Swaroop, A., Strong, L.C. and Suanders, G.F. (1991) Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell, 67, 1059-1074.
60 Hanson, I.M., Seawright, A., Hardman, K., Hodgson, S., Zaletayev, D., Fekete, G. and van Heyningen, V. (1993) PAX6 mutations in aniridia. Hum. Mol. Genet., 2, 915-920.MEDLINE Abstract
61 Hanson, I.M., Fletcher, M.M., Jordon, T., Brown, A., Taylor, D., Adams, R.J., Punnett, H.H. and van Heyningen, V. (1994) Mutations at the PAX6 locus are found in heterogenous anterior segment malformations including Peters' anomaly. Nature Genet., 6, 168-173.MEDLINE Abstract
62 Mirzayans, F., Pearce, W.G., MacDonald, I.M. and Walter, M.A. (1995) Mutation of the PAX6 gene in patients with autosomal dominant keratitis. Am. J. Hum. Genet., 57, 539-548.MEDLINE Abstract
63 Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J. and Maas, R.L. (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature Genet., 7, 463-471.MEDLINE Abstract
64 Brunelli, S., Faiella, A., Capra, V., Nigro, V., Simeone, A., Cama, A. and Boncinelli, E. (1996) Germline mutations in the homeobox gene EMX2 in patients with severe schizencephaly. Nature Genet., 12, 94-96.MEDLINE Abstract
65 MacDermot, K.D., Winter, R.M., Taylor, D. and Baraitser, M. (1990) Oculofacialbulbar palsy in mother and son: review of 26 reports of familial transmission within the `Moebius spectrum of defects'. J. Med. Genet., 27, 18-26.
66 Legum, C., Godel, V. and Nemet, P. (1981) Heterogeneity and pleiotropism in the Moebius syndrome. Clin. Genet., 20, 254-259.MEDLINE Abstract
67 Slee, J.J., Smart, R.D. and Viljoen, D.L. (1991) Deletion of chromosome 13 in Moebius syndrome. J. Med. Genet., 28, 413-414.MEDLINE Abstract
68 Wenger, S.L., Giangreco, C.A., Tarleton, J. and Wessel, H.B. (1995) No fragility at trinucleotide repeats in congenital myotonic dystrophy. Am. J. Hum. Genet., 57, A790.
69 Bowcock, A.M., Ruiz-Linares, A., Tomfohrde, J., Minch, E., Kidd, J.R. and Cavalli-Sforza, L.L. (1984) High resolution of human evolutionary trees with polymorphic microsatellites. Nature, 368, 455-457.
70 Rubinsztein, D.C., Amos, W., Leggo, J., Goodburn, S., Jain, S., Li, S.-H., Margolis, R.L., Ross, C.A. and Ferguson-Smith, M.A. (1995) Microsatellite evolution-evidence for directionality and variation between species. Nature Genet., 10, 337-343.MEDLINE Abstract
71 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
72 Altschul, A.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410.
73 Worley, K.C., Wiese, B.A. and Smith, R.F. (1995) BEAUTY: an enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results. Genome Res., 5, 173-184.MEDLINE Abstract
74 Henikoff, S., Henikoff, J.G., Alford, W.J. and Pietrokovski, S. (1995) Automated construction and graphical presentation of protein blocks from unaligned sequences. Gene, 163, 17-26.
75 American Psychiatric Association (1987) Diagnostic and Statistical Manual of MentalDisorders. Revised. American Psychiatric Press, Washington, DC.
76 Endicott, J. and Spitzer, R.L. (1978) A diagnostic interview: the schedule for affective disorders and schizophrenia. Arch. Gen. Psychiatr., 35, 837-844.MEDLINE Abstract
77 Jain, S., Leggo, J., DeLisi, L.E., Crow, T.J., Margolis, R.L., Li, S.-H., Goodburn, S., Walsh, C., Paykel, E.S., Ferguson-Smith, M.A., Ross, C.A. and Rubinsztein, D.C. (1996) Analysis of thirteen trinucleotide repeat loci as candidate genes for schizophrenia and bipolar affective disorder. Am. J. Med. Genet., in press.MEDLINE Abstract
78 Spitzer, R.L., Endicott, J. and Robins, E. (1978) Research diagnostic criteria: a rationale and reliability. Arch. Gen. Psychiatr., 35, 773-782.MEDLINE Abstract
79 Brando, L.J., Yolken, R., Herman, M.M., Kleinman, J.E., Ross, C.A. and Torrey, E.F. (1996) Analysis of the DRPLA triplet repeat in brain tissue and leukocytes from schizophrenics. Psychiatr. Genet., in press. MEDLINE Abstract
80 Drwinga, H.L., Toji, L.H., Kim, C.H., Greene, A.E. and Mulivor, R.A. (1993) NIGMS human/rodent somatic cell hybrid mapping panels 1 and 2. Genomics, 16, 311-314.MEDLINE Abstract
81 Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G. and Lathrop, M. (1992) A second-generation linkage map of the human genome. Nature, 359, 794-801.MEDLINE Abstract
82 Ott, J. (1991) Analysis of Human Genetic Linkage. Revised edition. The Johns Hopkins University Press, Baltimore, MD.
83 Lawrence, S., Morton, N.E. and Cox, D.R. (1991) Radiation hybrid mapping. Proc. Natl Acad. Sci. USA, 88, 7477-7480.MEDLINE Abstract
*To whom correspondence should be addressed at: Department of Psychiatry, Johns Hopkins University School of Medicine, 618 Ross Research Building, 720 Rutland Avenue, Baltimore, MD 21205-2196, USA
This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996
