Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hendrickx, J.
Right arrow Articles by Willems, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hendrickx, J.
Right arrow Articles by Willems, P. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 649-652
X-linked liver glycogenosis type II (XLG II) is caused by mutations in PHKA2, the gene encoding the liver [alpha] subunit of phosphorylase kinase
Introduction
Results
Discussion
Materials And Methods
   Patients
   Procedures
Acknowledgements
References

X-linked liver glycogenosis type II (XLG II) is caused by mutations in PHKA2, the gene encoding the liver [alpha] subunit of phosphorylase kinase

X-linked liver glycogenosis type II (XLG II) is caused by mutations in PHKA2 , the gene encoding the liver [alpha] subunit of phosphorylase kinase Jan Hendrickx, Erna Dams, Paul Coucke, Philip Lee1, John Fernandes2 and Patrick J. Willems*

Department of Medical Genetics, University of Antwerp-UIA, Universiteitsplein 1, Antwerp, Belgium, 1Department of Child Health, St George's Hospital Medical School, Cranmer Terrace, London, UK and 2Department of Pediatrics, University of Groningen, Oostersingel 59, Groningen, The Netherlands

Received December 14, 1995; Revised and Accepted February 15, 1996

X-linked liver glycogenosis type II (XLG II) is a recently described X-linked liver glycogen storage disease, mainly characterized by enlarged liver and growth retardation. These clinical symptoms are very similar to those of XLG I. In contrast to XLG I patients, however, XLG II patients do not show an in vitro enzymatic deficiency of phosphorylase kinase (PHK). Recently, mutations were identified in the gene encoding the liver [alpha] subunit of PHK (PHKA2) in XLG I patients. We have now studied the PHKA2 gene of four unrelated XLG II patients and identified four different mutations in the open reading frame, including a deletion of three nucleotides, an insertion of six nucleotides and two missense mutations. These results indicate that XLG II is due to mutations in PHKA2. In contrast to XLG I, XLG II is caused by mutations that lead to minor structural abnormalities in the primary structure of the liver [alpha] subunit of PHK. These mutations are found in a conserved RXX(X)T motif, resembling known phosphorylation sites that might be involved in the regulation of PHK. These findings might explain why the in vitro PHK enzymatic activity is not deficient in XLG II, whereas it is in XLG I.

INTRODUCTION

X-linked liver glycogenosis (XLG) is a benign glycogen storage disease (1 ). The main characteristics are accumulation of glycogen in the liver leading to hepatomegaly and growth retardation (1 ). XLG patients can be divided into two subgroups. Patients belonging to the first subgroup (XLG I) show a clear-cut enzymatic deficiency of phosphorylase kinase (PHK) in liver, erythrocytes and leukocytes (1 ,2 ). The second subgroup (XLG II) harbours patients with a similar clinical picture, but normal in vitro activity of PHK (3 ). Recently, the gene encoding the liver [alpha] subunit of PHK (PHKA2) was shown to harbour the mutations leading to XLG I (4 ,5 ). PHKA2 is also a good candidate for XLG II as both the XLG II gene (2 ) and PHKA2 (6 -8 ) map to the same chromosomal region Xp22. To exclude or prove that PHKA2 is the XLG II gene, we performed a mutation analysis in the PHKA2 gene from XLG II patients.

RESULTS

Patient 1 belongs to a Dutch XLG II family that was used to map the XLG II gene (3 ) (Fig. 1 a). Seven partially overlapping fragments were amplified by RT-PCR on mRNA isolated from EB-transformed lymphocytes. Together, these seven fragments contain the complete PHKA2 open reading frame (ORF). Sequence analysis of the different fragments revealed an insertion of six nucleotides (GGACCC) between nucleotides 3331 and 3332. This mutation results in the insertion of a novel threonine and arginine residue between arginine 1111 and glutamic acid 1112 of the protein (R1111insTR). As the insertion introduces a new AvaII recognition site, it can easily be detected at the genomic level by AvaII digestion of the PCR product, amplified with primers F43 and R49, giving two novel small fragments of 85 and 60 bp, respectively (Fig. 1 a). The mutation cosegregates with the disease and is present in the three male patients and both obligate heterozygotes in family 1, whereas the unaffected brother and 50 female controls only show the normal allele.


Figure 1. Detection of PHKA2 mutations in XLG II families. (A) Insertion of six nucleotides in family 1, yielding a novel AvaII restriction site. PCR was carried out on genomic DNA using primers F43 and R49. This yields a normal fragment of 139 bp. Digestion of the PCR product with AvaII does not cut the normal allele but yields two fragments of 85 and 60 bp if the insertion is present. Patient 1, his affected nephew and grandfather only show the mutant allele (the digested 85/60 bp fragments), whereas the two obligate carriers are heterozygous for the normal 139 bp fragment and the mutant 85/60 bp fragments. (B) C to T missense mutation at nucleotide position 556 in family 2. The mutant (antisense) sequence is shown at the left, and the wild-type (antisense) sequence at the right. The arginine at amino acid position 186 is replaced by a cysteine (R186C). (C) C to T missense mutation in family 3 introducing a novel MboI restriction site. The individuals available for the DNA analysis are indicated by Arabic numbers. PCR was carried out on genomic DNA. Using primers F44 and R60, a 64 bp fragment was amplified. To facilitate the analysis, primer R60 was designed in a way that a second MboI site, located 10 bp upstream of the mutation site, was destroyed. The PCR fragment was digested with MboI, yielding two novel fragments of 31 and 33 bp (not separated) in the mutant PCR product. All four patients (III1, IV3, V1 and V2) show the mutant allele, whereas the three mothers (III2, IV1 and IV2) are heterozygous for the mutation. (D) Deletion of three nucleotides in family 4, destroying a TaqI I site. PCR with primers F37 and R41 yields a normal fragment of 238 bp. The normal PCR product is digested into a 159 and a 79 bp fragment by TaqI, whereas the mutant 235 bp fragment is not digested by TaqI. Patient 3 is hemizygous for the mutation (undigested 235 bp fragment), whereas his mother is heterozygous (both the undigested 235 bp fragment and the digested 159/73 bp fragments.

A second PHKA2 mutation was identified in XLG II patient 2 who belongs to an XLG II family of Cypriotic descent that was included in the genetic localization studies of the XLG II gene (3 ). Sequence analysis of the RT-PCR products comprising the complete ORF of PHKA2 revealed a single mutation changing the C at nucleotide position 556 of the ORF into T, thereby replacing arginine at position 186 by cysteine (R186C) (Fig. 1 b). A modified PCR was performed for detection of the R186C mutation, using primers F49 and R55. R55 is designed to introduce a novel HhaI restriction in the normal PCR product. Because the genomic structure of the region containing the R186C mutation is still unknown, the presence of this mutation could not be analysed at the genomic level. However, PCR on cDNA from 23 male and 12 female controls (47 normal X chromosomes) with primers F49 and R55, did not reveal the presence of the mutation in the control population.

As lymphoblastoid cell lines from the other XLG II patients were not available for RNA extraction, RT-PCR could not be performed and the mutation analysis was carried out at the genomic level. Several exons of the PHKA2 gene of these patients were amplified by PCR, and the PCR fragments were analysed by SSCP.

A third mutation was identified in a Dutch XLG II patient belonging to one of the families included in the genetic localization study of the XLG II gene (3 ). A different SSCP migration pattern was observed for the PCR product of genomic DNA containing the exon between nucleotide positions 3337 and 3537 of the ORF. Sequence analysis of this PCR product revealed a point mutation changing the C at position 3341 into T. This mutation results in the substitution of threonine at amino acid position 1114 by isoleucine (T1114I). As this mutation introduces a novel MboI restriction site, it can be analysed by MboI digestion of the PCR product containing the mutation, using primers F44 and R60 (Fig. 1 c). The T1114I mutation was absent in 50 healthy female controls.

The fourth mutation in PHKA2 was identified in an isolated XLG II patient originating from the UK. A different SSCP migration pattern was observed for the genomic PCR fragment that contained the exon between cDNA nucleotide positions 718 and 864. Sequence analysis of the PCR fragment revealed a deletion of nucleotides 750-752 in the ORF, resulting in the deletion of a threonine residue in the PHKA2 protein ([Delta]T251). As this mutation destroys a TaqI restriction site, it can be detected by TaqI digestion of the PCR product of this PHKA2 exon, using primers F37 and R41 (Fig. 1 d). The [Delta]T251 mutation was not present in a control population of 50 healthy female controls, indicating that it is not a common polymorphism.

The exons containing the [Delta]T251, the R111insTR and the T1114I mutations were analysed for mutations in six additional XLG II patients. However, normal SSCP migration patterns were observed in these patients.

DISCUSSION

Our finding of four different mutations in PHKA2 of XLG II patients indicates that PHKA2 is responsible for XLG II. This proves that both types of XLG are caused by mutations in a single gene PHKA2. It is intriguing, however, that some PHKA2 mutations lead to diminished in vitro PHK activity (XLG I), whereas other mutations do not (XLG II). The PHKA2 mutations found in XLG I include three stop codon mutations (Q766Stop, Q1009Stop and S1049Stop) leading to a truncated [alpha] subunit (7 ), a splice site mutation leading to exon skipping with deletion of 34 amino acids (7 ), and a substitution of a very conserved proline for a leucine (P1205L) (8 ) (Fig. 2 ). All five mutations most likely lead to instability of the [alpha] subunit. The sixth PHKA2 mutation identified so far in XLG I is a deletion of phenylalanine ([Delta]F141); the functional significance of this mutation is unclear. The mutations found in XLG I patients are likely to affect the stability of the [alpha] subunit, which probably results in a diminished amount of PHK activity.


Figure 2. Position of XLG mutations in the PHKA2 open reading frame. The XLG I mutations are shown on top, whereas the XLG II mutations are shown below.

The four PHKA2 mutations found in XLG II patients (Figs 2 and 3 ) are of a different kind. The insertion of threonine-arginine (R1111insTR), the substitution of arginine by cysteine (R186C), the substitution of threonine by isoleucine (T1114I), and the deletion of threonine ([Delta]T251) are in-frame mutations leading to minor changes in the primary amino acid structure of PHKA2. Probably, these mutations do not impair the stability of the [alpha] subunit or the PHK holoenzyme, but affect the regulation of the PHK enzyme. Although PHK has been thoroughly studied, the regulation of the enzyme and the interaction between the different subunits are still not well understood. This is partially due to the structural complexity of PHK. PHK is composed of four different subunits [alpha], [beta], [gamma] and [delta] (calmodulin). The [gamma] subunit is the catalytic subunit, and its activity is suppressed by interaction with the [alpha], [beta] and [delta] subunits. If the [gamma] subunit would be freely present in the cell, this would result in an extensive and uncontrolled glycogenolysis. Therefore, the cell is protected against the presence of free [gamma] subunit by a reduced [gamma] subunit expression if the amount of inhibitory [alpha], [beta] and [delta] subunits is insufficient to regulate the catalytic activity (D. A. Walsh, personal communication). PHKA2 contains putative phosphorylation sites and calmodulin binding sites that might be involved in regulation of PHK. However, the four mutations found in PHKA2 from patients with XLG II, are not located in these regulatory sequences. Remarkably, these four XLG II mutations all involve a RXX(X)T motif which is highly conserved between humans, rabbits and mice in liver PHKA (PHKA2) and muscle PHKA (PHKA1) (Fig. 3 ). The functional significance of this motif in the regulation of PHK is currently unknown. The RXX(X)T motif, however, resembles phosphorylation sites recognized by different protein kinases including cyclic AMP-dependent protein kinase (cAPK), MAP kinase, AMP-activated protein kinase (AMPK), calmodulin- dependent protein kinase I, S6 kinase and p34cdc2-activating kinase (CAK). Therefore, PHK activity might be regulated by phosphorylation of these sites, although the actual phosphorylation sites are unknown. In that case, XLG II would be due to impaired activation of PHK activity. The classical in vitro enzymatic assay of PHK essentially only measures the activity of the [gamma] subunit in its non-activated form, and does not determine how much [gamma] subunit can be activated under physiological conditions. This might be an explanation of the apparent discrepancy between the normal in vitro enzymatic activity of PHK in XLG II patients and their clinical picture, which is most likely due to an in vivo deficient PHK activity (3 ,9 ).


Figure 3.Amino acid alignment of human and rabbit PHKA2, and human, rabbit and mouse PHKA1 sequences around the mutation sites found in XLG II patients.

The location of XLG II mutations might identify functional domains in PHKA2 involved in the regulation of PHK, and thereby form a starting point for functional studies of the interaction of the different subunits of this important protein kinase.

MATERIALS AND METHODS

Patients

Families 1 and 3 are Dutch, with three and four XLG II patients, respectively; whereas family 2 originates from Cyprus and contains four XLG II patients. These three families were used in the genetic localization study of XLG II as published previously (3 ). Patient 4 is an isolated patient, originating from the UK. All patients show growth retardation in infancy, hepatomegaly and elevation of the liver enzymes as their main clinical symptoms. Enzymatic data of families 1, 2 and 3 have been published before (3 ). In conclusion, there was no deficiency of PHK in leukocytes or erythrocytes, nor could any other enzymatic defect be found in these families. In patient 4, PHK activity of erythrocytes was within the normal range.

Procedures

mRNA was isolated from EB transformed cell lines using TrizolTM (Life Technologies) according to the manufacturer's recommendations. First strand cDNA was synthesized using the Superscript Preamplification System (Life Technologies). PCR on genomic or cDNA was performed under standard conditions. Primer sets used were as follows: F43 (GAATCTGACTGAAATGCGCTC) and R49 (CTTATTGTGAACCCACAGAGG) for SSCP and restriction analysis of the R1111insTR mutation; F49 (AAGCTGCATATAAAGTCGCTG) and R55 (CCTGATTAGTCTTATCTCCGC) for restriction analysis of the R186C mutation; F44 (TGGTGGTTGTCTGCCTGTCCC) and R48 (CCAGCCAACCCAGCTCCCTGG) for SSCP, and F44 and R60 (ACATGGACAGCAAACTTGTTC), for restriction analysis of the T1114I mutation; and F37 (GCCTATTACGCATCTCCAGG) and R41 (catcgacacaggacagaagg) for SSCP and restriction analysis of the [Delta]T251 mutation. Temperatures were optimized for the different primer sets. Prior to sequencing, PCR fragments were subcloned in the SmaI restriction site of pUC18 using the Sureclone ligation kit (Pharmacia). SSCP analysis was performed using a 0.5* MDE gel (G.T. Baker Inc.) in 0.5* TBE buffer at room temperature with 10% glycerol or at 4oC without glycerol. The samples were electrophoresed overnight at 400 V. Sequence reactions were performed on an Applied Biosystems 373A automatic sequencer using the PRISMTM ready reaction dye primer cycle sequencing kit.

ACKNOWLEDGMENTS

We thank D. Walsh, G. Carlson, L. Heilmeyer and G. Hardie for comments. This work was supported by a grant of the Nationaal Fonds voor Wetenschappelijk Onderzoek (NFWO) to P.J.W. and by a concerted action of the University of Antwerp to P.J.W.

REFERENCES

1 Huijing, F. and Fernandes, J. (1969) X-chromosomal inheritance of liver glycogenosis with phosphorylase kinase deficiency. Am. J. Hum. Genet., 21, 275-284. MEDLINE Abstract

2 Willems, P.J., Hendrickx, J., Van der Auwera, B.J., Vits, L., Raeymaekers, P., Coucke, P.J., Van den Bergh, I., Berger, R., Smit, G.P.A., Van Broeckhoven, C., Kilimann, M.W., Van Elsen, A. and Fernandes, J.F. (1991) Mapping of the gene for X-linked liver glycogenosis due to phosphorylase kinase deficiency to human chromosome region Xp22. Genomics, 9, 565-569. MEDLINE Abstract

3 Hendrickx, J., Coucke, P., Hors-Cayla, M-C., Smit, G.P.A., Smeitink, J., Berger, R., Lee, P., Shin, Y.S., Deutsch, J., Fernandes, J. and Willems, P.J. (1994) Localization of a new type of X-linked liver glycogenosis to the chromosomal region Xp22 containing the liver [alpha]-subunit of phosphorylase kinase (PHKA2). Genomics, 21, 620-625. MEDLINE Abstract

4 Hendrickx, J., Coucke, P., Dams, E., Lee, P., Corbeel, L., Odièvre, M., Fernandes, J.F and Willems P.J. (1995) Mutations in a phosphorylase kinase gene PHKA2 are responsible for X-linked liver glycogenosis. Hum. Mol. Genet., 4, 77-83. MEDLINE Abstract

5 Berg, I.E.T., van Beurden, E.A.C.M., Malingré, H.E.M., van Amstel, H.K.P., Poll-The, B.T., Smeitink, J.A.M., Lamers, W.H. and Berger, R. (1995) X-linked liver phosphorylase kinase deficiency is associated with mutations in the human liver phosphorylase kinase [alpha] subunit. Am. J. Hum. Genet., 56, 381-387.

6 Hendrickx, J., Coucke, P., Bossuyt, P., Wauters, J., Raeymaekers, P., Marchau, F., Smit, G.P.A., Stolte, I., Sardharwalla, I.B., Berthelot, J., Van den Bergh, I., Berger, R., Van Broeckhoven, C., Baussan, C., Wapenaar, M., Fernandes, J. and Willems, P.J. (1993) X-linked liver glycogenosis: localization and isolation of a candidate gene. Hum. Mol. Genet., 2, 583-589. MEDLINE Abstract

7 Davidson, J.J., Özçelik, T., Hamacher, C., Willems, P.J., Francke, U. and Kilimann, M.W. (1992) cDNA encoding a liver isoform of the phosphorylase kinase [alpha] subunit: its structural gene maps to the locus of X-linked liver glycogenosis. Proc. Natl Acad. Sci. USA, 89, 2096-2100. MEDLINE Abstract

8 Wauters, J., Bossuyt, P., Davidson, J., Hendrickx, J., Kilimann, M.W. and Willems, P.J. (1992) Regional mapping of a liver [alpha]-subunit gene of phosphorylase kinase to the distal region of chromosome Xp. Cytogenet. Cell Genet., 60, 194-196. MEDLINE Abstract

9 Maire, I., Baussan, C., Moatti, N., Mathieu, M. and Lemonnier, A. (1991) Biochemical diagnosis of hepatic glycogen storage disease: 20 years of French experience. Clin. Biochem., 24, 169-178. MEDLINE Abstract

*To whom correspondence should be addressed

This page is maintained by OUP admin. Last updated Thu Oct 31 15:23:49 GMT 1996. Part of the OUP Journals World Wide Web service.Copyright Oxford University Press, 1996


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
N. A. Ayers, D. A. Wilkinson, T. J. Fitzgerald, and G. M. Carlson
Self-association of the alpha Subunit of Phosphorylase Kinase as Determined by Two-hybrid Screening
J. Biol. Chem., December 10, 1999; 274(50): 35583 - 35590.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hendrickx, J.
Right arrow Articles by Willems, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hendrickx, J.
Right arrow Articles by Willems, P. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?