Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (82)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ferrell, R. E.
Right arrow Articles by Finegold, D. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrell, R. E.
Right arrow Articles by Finegold, D. N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 2073-2078  

Hereditary lymphedema: evidence for linkage and genetic heterogeneity
Introduction
Results
Discussion
Materials And Methods
Acknowledgements
References

Hereditary lymphedema: evidence for linkage and genetic heterogeneity

Hereditary lymphedema: evidence for linkage and genetic heterogeneity

Robert E. Ferrell1, Kara L. Levinson1, Judith H. Esman2, Mark A. Kimak1, Elizabeth C. Lawrence1, M. Michael Barmada1 and David N. Finegold1,3,*

Departments of 1Human Genetics, 2Physical Medicine and Rehabilitation and 3Pediatrics, University of Pittsburgh, 130 DeSoto Street, Pittsburgh, PA 15261, USA

Received 8 June 1998; Revised and Accepted September 14, 1998

Hereditary or primary lymphedema is a developmental disorder of the lymphatic system which leads to a disabling and disfiguring swelling of the extremities. Hereditary lymphedema generally shows an autosomal dominant pattern of inheritance with reduced penetrance, variable expression and variable age at onset. Three multigeneration families demonstrating the phenotype of hereditary lymphedema segregating as an autosomal dominant trait with incomplete penetrance were genotyped for 366 autosomal markers. Linkage analysis yielded a two-point LOD score of 6.1 at [thetas] = 0.0 for marker D5S1354 and a maximum multipoint LOD score of 8.8 at marker D5S1354 located at chromosome 5q34-q35. Linkage analysis in two additional families using markers from the linked region showed one family consistent for linkage to distal chromosome 5. In the second family, linkage to 5q was excluded for all markers in the region with LOD scores Z < -2.0. The vascular endothelial growth factor C receptor (FLT4) was mapped to the linked region, and partial sequence analysis identified a G->A transition at nucleotide position 3360 of the FLT4 cDNA, predicting a leucine for proline substitution at residue 1126 of the mature receptor in one nuclear family. This study localizes a gene for primary lymphedema to distal chromosome 5q, identifies a plausible candidate gene in the linked region, and provides evidence for a second, unlinked locus for primary lymphedema.

INTRODUCTION

Hereditary or primary lymphedema, first described by Milroy in 1892 (1), is a developmental disorder of the lymphatic system which leads to a disabling and disfiguring swelling of the extremities. Hereditary lymphedema generally shows an autosomal dominant pattern of inheritance with reduced penetrance, variable expression and variable age at onset (2). Swelling may appear in one or all limbs. Swelling varies in degree and distribution, and, if untreated, worsens over time. In rare instances, angiosarcoma may develop in affected tissues (3). Despite having been described over a century ago, little is known about the developmental regulation of the lymphatic system, and little progress has been made in understanding the mechanisms causing lymphedema. To identify a gene or genes contributing to susceptibility to develop lymphedema, we identified families with inherited lymphedema and conducted a linkage and positional candidate gene analysis.

RESULTS

We ascertained families using referrals from lymphedema treatment programs, lymphedema support groups and the worldwide web. The first family ascertained was a large multigenerational family demonstrating early onset lymphedema. Forty individuals of this family were examined and DNA sampled. Blood was obtained from another 11 members from mailing kits. Linkage simulation was performed using SLINK (4) and linkage was analyzed using MSIM (5) to estimate the potential power of two-point linkage analysis in the family. Marker genotypes were simulated for a marker with heterozygosity of 0.875 under a linked ([thetas] = 0) and unlinked ([thetas] = 0.5) model using the 51 available individuals. The simulation showed that the power to detect linkage was >90% for a LOD score threshold of Z([thetas]) [ge] 2.0. The false positive rate was <5% (6). Shortly thereafter, two additional families segregating for autosomal dominant lymphedema were identified. These three families (Fig. 1, families 101, 106 and 111) were genotyped for 366 autosomal markers by the NHLBI Mammalian Genotyping Service (www.marshmed.org/genetics ). Genotypes were checked for consistency using Pedcheck (7). Two-point linkage analysis was performed using VITESSE (8). The model for linkage assumed an autosomal dominant model of inheritance, a disease allele frequency of 0.0001 and a penetrance of 0.80. Figure 2 summarizes the genome scan. A summed LOD score of >4.0 was observed from distal chromosome 5, markers D5S1456, D5S817 and D5S488. LOD scores >2.0 ([thetas] = 0-0.15) were detected for chromosome 12 (D12S391 Z = 2.03, all families) and chromosome 21 (D21S1440 Z = 2.62, all families). The largest two-point LOD (Z = 4.3; [thetas] = 0) was observed for marker D5S408 localized to chromosome 5q34-q35. This mapping was refined by genotyping these families for eight additional markers localized to region 5q34-q35. Six of these were informative for linkage (D5S653, D5S498, D5S408, D5S2006, D5S1353 and D5S1354). Linkage analysis of these markers using VITESSE yielded a two-point LOD score of 6.1 at [thetas] = 0 for marker D5S1354 (Table 1) and a maximum multipoint LOD score of 8.8 at marker D5S1354 (Fig. 3). These findings support the localization of a gene within chromosome band 5q34-q35 that is a predisposing factor in hereditary lymphedema.


Figure 1. Pedigrees of five lymphedema families informative for linkage. Filled symbols represent individuals with clinically documented lymphedema. Crossed symbols represent individuals with an ambiguous phenotype. An ambiguous phenotype is defined as self-reported swelling of the limbs with no known cause, without a clinical diagnosis of lymphedema. Individuals of ambiguous phenotype were coded as disease status unknown for the linkage analysis. The proband in each family is indicated by an arrow.


Figure 2. Summary of LOD scores from two-point linkage analysis of 366 autosomal markers in three lymphedema families (101, 106 and 111). Significant evidence of linkage Z > 3.0 was only observed for markers on distal chromosome 5q.


Figure 3. Summary of VITESSE analysis of lymphedema families with markers localized to chromosome 5q34-q35. The one LOD confidence interval lies completely within the interval flanked by markers D5S1353 and D5S408 and overlaps the most likely location of FLT4. Linkage is excluded for the entire region for family 135.

During the completion of the genome scan, an additional 10 lymphedema families were ascertained. Two of these families, 105 and 135 from Figure 1, were potentially informative for linkage and were genotyped for markers in the linked region. Examination of the two-point LOD scores for the five informative families for markers in the linked region (Table 1) shows that four of the families (101, 105, 106 and 111) are consistent with linkage to chromosome 5q while family 135 excluded linkage across the entire region, with LOD scores Z < -2.0 for all markers. Multipoint linkage analysis of families 101, 105, 106 and 111 (Fig. 3) yielded a peak LOD score of Z = 10 at marker D5S1354. These findings support the existence of at least two loci which predispose to hereditary lymphedema.

The order of markers D5S1353, D5S1354 and D5S408 with respect to each other is uncertain. Multipoint linkage analysis using alternative orders for these markers gave similar results. Marker D5S498 is a framework marker and marker D5S408 is mapped 11.2 cM distal to D5S498 based on the CHLC chromosome 5 sex-averaged, recombination-minimized map, version 3 (www.chlc.org ). The physical distance between D5S498 and D5S408 is estimated as 1.45 Mb based on the Genetic Location Database (LDB) chromosome 5 summary map (cedar.genetics.soton.ac.uk/public_html/ ).

A query of the Human Genome Database (gdbwww.gdb.org ), LDB and Online Mendelian Inheritance In Man (www3.ncbi.nih.nlm.gov/omim ) identified 16 genes within this region. Two of these genes have been identified as having roles in development (MSX2 and FLT4). MSX2 was considered an unlikely candidate gene for lymphedema because of its known involvement in craniofacial development (9). FLT4, the gene encoding vascular endothelial growth factor C receptor, appeared to be a likely candidate gene for the following reasons: (i) FLT4 is expressed in developing lymphatic endothelium in the mouse (10,11); (ii) expression of FLT4 is induced in differentiating avian chorioallantoic membrane (12); and (iii) overexpression of VEGF-C, a ligand of FLT4, leads to hyperplasia of the lymphatic vessels in transgenic mice (13).

Table 1. LOD scores for individual families estimated over the interval defined by markers D5S498 and D5S2006
Family no. Z([thetas])
Locus 0.0 0.01 0.05 0.1 0.2
D5S498
101 -3.18 -2.33 -0.45 0.42 0.88
106 1.08 1.07 1.05 0.99 0.81
111 -0.85 -0.77 -0.53 -0.34 -0.13
105 1.22 1.20 1.11 0.98 0.72
135 -2.48 -1.85 -1.12 -0.75 -0.38
D5S1353
101 -2.99 -2.48 -1.21 -0.63 -0.18
106 0.28 0.29 0.35 0.38 0.38
111 -1.06 -1.02 -0.88 -0.72 -0.42
105 0.72 0.71 0.65 0.56 0.39
135 -8.03 -4.18 -2.09 -1.13 -0.30
D5S1354
101 6.09 6.02 5.69 5.21 4.07
106 1.42 1.40 1.32 1.20 0.96
111 0.21 0.22 0.23 0.24 0.22
105 0.43 0.42 0.40 0.36 0.28
135 -6.88 -4.91 -3.20 -2.16 -1.07
D5S408
101 2.80 2.74 2.50 2.20 1.56
106 0.66 0.68 0.73 0.76 0.71
111 -1.70 -1.40 -0.80 -0.44 -0.10
105 0.42 0.41 0.38 0.35 0.27
135 -5.22 -4.24 -2.58 -1.67 -0.80
D5S2006
101 4.51 4.70 4.85 4.66 3.80
106 1.17 1.16 1.11 1.03 0.83
111 -1.32 -1.18 -0.82 -0.56 -0.25
105 0.43 0.42 0.40 0.36 0.28
135 -3.86 -3.20 -2.11 -1.45 -0.73

To explore the potential role of FLT4 in lymphedema, probands from the 13 independently ascertained lymphedema families were screened for variation by direct sequencing of portions of the FLT4 gene. The sequencing strategy used amplification primers from the FLT4 cDNA sequence (GenBank accession no. X68203) and information on the genomic organization of the related vascular endothelial growth factor receptor-2 (KDR/flk-1) (14). Genomic sequence from ~50% of the FLT4 gene was determined and five single nucleotide variants were observed. Two of these occurred in introns and a third was a synonymous substitution in predicted exon 3. These intragenic polymorphisms were used to map the FLT4 gene. As shown in Figure 3, FLT4 maps within the region of chromosome 5q linked to the lymphedema phenotype, consistent with it being a candidate gene. In two families, 127 (pedigree not shown) and 135, a C->T transition was identified at nucleotide position 1940 of the FLT4 cDNA (GenBank accession no. X68203). This nucleotide substitution is predicted to lead to a non-conservative substitution of serine for proline at residue 647 (putative exon 12) of the mature receptor. However, this sequence change was observed in two of 120 randomly selected individuals from the general population (240 alleles), and in one of the two families in which this variant was initially detected, family 135, linkage between lymphedema and chromosome 5q markers was excluded (Table 1; Fig. 3). In probands from the other 10 families, wild-type sequence was observed at nucleotide position 1940. The results suggest that this variant is not causative.

In one nuclear family (pedigree not shown), a G->A transition was observed at nucleotide position 3360 of the FLT4 cDNA. This nucleotide substitution is predicted to lead to a non-conservative substitution of leucine for proline at residue 1126 of the mature receptor. This mutation is predicted to lie in the intracellular tyrosine kinase domain II involved in intracellular signaling (15). Direct sequencing of predicted exon 20 in this family identified this substitution only in affected and at-risk family members. This sequence change was not observed in 120 randomly selected individuals of mixed European ancestry from the general population (240 alleles). In probands from the other 11 families, wild-type sequence was observed at nucleotide position 3360.

DISCUSSION

This is the first study localizing a gene in which mutation predisposes to familial lymphedema. A multipoint LOD of Z = 10 provides compelling support for the location of one lymphedema locus on distal chromosome 5 in the 1.45 Mb region flanked by markers D5S498 and D5S408. This study also provides evidence of locus heterogeneity in lymphedema. In one family (number 135), linkage to distal chromosome 5 markers is excluded with odds >105:1. Genetic heterogeneity is consistent with the clinical literature (16,17). Milroy-Nonne (OMIM 153100) syndrome-early onset lymphedema (1,17) and lymphedema praecox (Meige syndrome, OMIM 153200)-late onset lymphedema (18-20) are described as separate entities both with dominant inheritance. However, there is confusion in the literature about the separation of these disorders. In Milroy's syndrome, the presence of edema, which is usually more severe in the lower extremities, is seen from birth. Lymphedema praecox presents in a similar fashion but the onset of swelling is usually around puberty. Some cases have been reported to develop in the post-pubertal period. The families showing linkage to 5q34-q35 show an early onset for most affected individuals, but individuals in these pedigrees have presented during or after puberty. Furthermore, the family which was unlinked to 5q34-q35 was not distinguishable from the linked families in terms of reported age at onset or clinical characteristics (data not shown). Thus, it appears that variation in age at onset both within and between families represents variation in expression of mutation in response to as yet unknown environmental or biological factors and is not strictly determined by underlying genetic heterogeneity. Defining the relationship between mutations at specific loci and clinical phenotypes will require the detailed characterization of additional linked and unlinked families.

The lymphatic system is a complex structure organized in parallel fashion to the circulatory system. In contrast to the circulatory system which utilizes the heart to pump blood throughout the body, the lymphatic system must pump lymph fluid using the inherent contractility of the lymphatic vessels. The lymphatic vessels are not interconnected as are the blood vessels, but rather form a set of coordinated structures including the initial lymphatic sinuses (13,21) which drain into the lymphatic capillaries and subsequently to the collecting lymphatics which drain into the lymphatic trunks and the thoracic duct which ultimately drains into the venous circulation. The composition of the channels through which lymph passes is varied (22,23), including the single epithelial layers of the initial lymphatics, the multiple layers of the collecting lymphatics including endothelium, muscular and adventitial layers, and the complex organization of the lymph node. The various organs of the body such as skin, lung and gastrointestinal tract have components of the lymphatics with various unique features (24-26). The localization of FLT4, a member of the vascular endothelial growth factor receptor gene family, to the linked region on 5q34-q35 identifies both a positional and a biologically plausible candidate gene. Coding sequence variants were observed in three families. However, one of these, a C->T transition at nucleotide position 1940, was observed at low frequency in a randomly ascertained population sample and in family 135, in which the lymphedema phenotype does not co-segregate with chromosome 5q marker alleles. The other variant, a G->A transition at nucleotide position 3360, is predicted to cause a non-conservative amino acid substitution in the mature receptor. However, this substitution was only observed in one nuclear family which was not informative for linkage. Assessment of the potential role of FLT4 in lymphedema awaits the completion of the genomic sequence and detailed mutation analysis of the entire gene.

These findings provide a basis for identifying genetically high risk members of lymphedema families for a detailed examination of the environmental factors that influence expression of the lymphedema phenotype (trauma, infection, environmental exposure, etc.). They provide a starting point for the analysis of expressed genes on distal chromosome 5q to identify a specific lymphedema susceptibility locus and provide a tool for classifying lymphedema families for the localization of other lymphedema loci.

MATERIALS AND METHODS

DNA was isolated from EDTA anti-coagulated whole blood by the method of Miller et al. (27) and from cytobrush specimens using the Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). Methods for analysis of the markers used in the genome scan are reported at the NHLBI Mammalian Genotyping Serviceweb site (www.marshmed.org/genetics/methods/pcr.html ; www.marshmed.org/genetics/methods/gel.html ).

Initial DNA sequencing primers were generated based on the reported human FLT4 cDNA sequence. Variable positions, the unique sequence primers used to amplify sequences flanking each variable site and the method of detecting each variant are given in Table 2.

Amplification and sequencing primers were synthesized by the DNA Synthesis Facility, University of Pittsburgh. Amplification primers were tagged at the 5[prime] end with the forward or reverse M13 universal sequence to facilitate direct sequencing. Amplimers were subjected to cycle sequencing using the dRhodamine terminator ready reaction kit or the Dye Primer ready reaction kit for -M13 and M13 Rev primers (Perkin Elmer) and analyzed on the Prism ABI 377 fluorescent sequencer. Sequences were aligned for further analysis using SEQUENCHER 3.0 (Gene Codes).

We identified 13 families from the USA and Canada through referrals from lymphedema treatment centers, lymphedema support groups and from our worldwide web site at www.pitt.edu/~genetics/lymph/ . The study protocol was approved by the Institutional Review Board of the University of Pittsburgh and participants gave written informed consent. All members of these families were of western European ancestry. Forty members of family 101 were examined during a family reunion by a physiatrist, Judith Esman MD, experienced in lymphedema treatment. They were considered affected if they exhibited asymmetry or obvious swelling of one or both legs. Members of the other 12 families were scored as affected if they had received a medical diagnosis of lymphedema or if there were personal and family reports of extremity swelling or asymmetry. Medical records were obtained to verify affection status whenever possible. Individuals with very mild or intermittent swelling, heavy set legs, obesity or a history of leg infections as the only feature were considered to have indeterminate disease status. In the 13 families, 105 individuals were classified as affected, with a male:female ratio of 1:2.3. The age of onset of lymphedema symptoms ranged from prenatal (diagnosed by ultrasound) to age 55. When affected by normal matings were analyzed, 76 of 191 children were affected, yielding a penetrance of 80%. First degree relatives of affected individuals were considered at risk.

Two-point linkage analysis was conducted using an autosomal dominant model predicting 80% penetrance in the heterozygous state, 99% penetrance in the homozygous state and a 1% phenocopy rate. The frequency of the disease allele was set at 1/10 000. Microsatellite marker allele frequencies were calculated by counting founder alleles, with the addition of counts of non-transmitted alleles. Multipoint analysis was carried out using distances obtained from the Location Database (LDB-http://cedar.genetics.soton.ac.uk/public html ). Multipoint and two-point analyses were facilitated using the VITESSE (v1.1) program (8).

Table 2. Location, primer sequences, amplification conditions and detection methods for five intragenic SNPs in the human FLT4 gene
Position Primer 1 sequence Primer 2 sequence Annealing temperature (°C) [MgCl2] Base change Detection
Exon 12 AA647 tcaccatcgatccaagc agttctgcgtgagccgag 56 1.0 mM C->T Sequencing
Exon 24 AA1126 caggacggggtgacttga gcccaggcctgtctactg 56 1.0 mM G->A Sequencing
Exon 3 AA175 ccagctcctacgtgttcg ggcaacagctggatgtca 56 1.0 mM G->T HhaI
65 bp 3[prime] to exon 6 ctgtgagggcgtgggagt gtcctttgagccactgga 54 1.5 mM G->A StyI
55 bp 3[prime] to exon 2 cacacgtcatcgacaccggtg ggcaacagctggatgtca 56 1.5 mM C->T ApaI
All amplifications were done for 35 cycles with denaturation at 94°C for 30 s, annealing as above for 30 s and extension at 72°C for 30 s.

ACKNOWLEDGEMENTS

We thank Dr Daniel E. Weeks for critical comments on this work, and Margaret Alexander and Jeremy Martinson for their technical assistance. We wish to thank the many family members who continue to participate in this study, and the National Lymphedema Network for their assistance. This work was supported by a generous grant and logistical support from the D.T. Watson Rehabilitation Hospital, Sewickley, PA, the NHLBI Mammalian Genotyping Service and NIH grant HD-35174. Additional information on this work may be found at www.pitt.edu/~genetics/lymph/ .

REFERENCES

1. Milroy, W.F. (1892) An undescribed variety of hereditary oedema. NY Med. J., 56, 505-508.

2. Greenlee, R., Hoyme, H., Witte, M., Crowe, P. and Witte, C. (1993) Developmental disorders of the lymphatic system. Lymphology, 26, 156-168. MEDLINE Abstract

3. Offori, T.W., Platt, C.C., Stephen, M. and Hopkinson, G.B. (1993) Angiosarcoma in congenital hereditary lymphedema (Milroy's disease)-diagnostic beacons and a review of the literature. Clin. Exp. Dermatol., 18, 174-177. MEDLINE Abstract

4. Weeks, D.E., Ott, J. and Lathrop, G.M. (1990) SLINK: a general simulation program for linkage analysis. Am. J. Hum. Genet., 47, A204. MEDLINE Abstract

5. Ott, J. (1989) Computer-simulation methods in human linkage analysis. Proc. Natl Acad. Sci. USA, 86, 4175-4178. MEDLINE Abstract

6. Levinson, K.L. (1996) Linkage analysis of hereditary lymphedema to chromosome 5: preliminary analysis for a genome scan. MS thesis, University of Pittsburgh, Pittsburgh, PA.

7. O'Connell, J.R. and Weeks, D.E. (1997) Pedcheck: a program for identifying marker typing incompatibilities in linkage analysis. Am. J. Hum. Genet., 61, A288.

8. O'Connell, J.R. and Weeks, D.E. (1995) The VITESSE algorithm for rapid exact multilocus linkage analysis via genotype set-recording and fuzzy inheritance. Nature Genet., 11, 402-408. MEDLINE Abstract

9. Jabs, E.W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I.S., Klisak, I., Sparkes, R., Warman, M.L., Mulliken, J.B., Snead, M.L. and Maxson, R. (1993) A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell, 75, 443-450. MEDLINE Abstract

10. Kukk, E., Lymboussaki, A., Taira, S., Kaipainen, A., Jeltsch, M., Joukov, V. and Alitalo, K. (1996) VEGF-C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development. Development, 122, 3829-3837. MEDLINE Abstract

11. Kaipainen, A., Korhonen, J., Mustonen, T., van Hinsbergh, V.W.M., Fang, G.-H., Dumont, D., Breitman, M. and Alitalo, K. (1995) Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc. Natl Acad. Sci. USA, 92, 3566-3570. MEDLINE Abstract

12. Oh, S.J., Jeltsch, M.M., Birkenhager, R., McCarthy, J.E.G., Weich, H.A., Christ, B., Alitalo, K. and Wilting, J. (1997) VEGF and VEGF-C: specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane. Dev. Biol., 188, 96-109. MEDLINE Abstract

13. Jeltsch, M., Kaipainen, A., Joukov, V., Meng, X., Lakso, M., Rauvala, H., Swartz, M., Fukumura, D., Jain, R.K. and Alitalo, K. (1997) Hyperplasia of lymphatic vessels in VEFG-C transgenic mice. Science, 276, 1423-1425. MEDLINE Abstract

14. Yin, L.-Y., Wu, Y., Ballinger, C.A. and Patterson, C. (1998) Genomic structure of the human KDR/flk-1 gene. Mamm. Genome, 9, 408-410. MEDLINE Abstract

15. Pajusola, K., Aperlikova, O., Korhonen, J., Kaipainen, A., Pertovaara, L., Alitalo, R. and Alitalo, K. (1992) FLT4 receptor tyrosine kinase contains seven immunoglobulin-like loops and is expressed in multiple human tissues and cell lines. Cancer Res., 52, 5738-5743. MEDLINE Abstract

16. Esterly, J.R. (1965) Congenital hereditary lymphedema. J. Med. Genet., 2, 93-98.

17. Dale, R.F. (1985) The inheritance of primary lymphedema. J. Med. Genet., 22, 274-278. MEDLINE Abstract

18. Lewis, J.M. and Wald, E.R. (1984) Lymphedema praecox. J. Pediatr., 104, 641-648. MEDLINE Abstract

19. Holmes, L.B., Fields, J.P. and Zabriskie, J.B. (1978) Hereditary late-onset lymphedema. Pediatrics, 61, 575-579. MEDLINE Abstract

20. Wheeler, E.S., Chan, V., Wassman, R., Rimoin, D.L. and Lesavoy, M.A. (1981) Familial lymphedema praecox: Meige's disease. Plastic Reconstructive Surg., 67, 362-364.

21. Castenholz, A. (1991) In Olszewski, W.L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press, Boca Raton, FL, pp. 15-42.

22. Olszewski, W.L. (1991) In Olszewski, W.L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press, Boca Raton, FL, pp. 235-258.

23. Kinmonth, J.B. (1972) In Kinmonth, J.B. (ed.), The Lymphatics: Diseases, Lymphography and Surgery. Edward Arnold Publishers, London, pp. 82-86.

24. Ohkuma, M. (1991) In Olszewski, W.L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press, Boca Raton, FL, pp. 157-190.

25. Uhley, H. and Leeds, S. (1991) In Olszewski, W.L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press, Boca Raton, FL, pp. 191-210.

26. Barrowman, J.A. (1991) In Olszewski, W.L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press, Boca Raton, FL, pp. 221-234.

27. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1998) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.

*To whom correspondence should be addressed. Tel: +1 412 624 3018; Fax: +1 412 624 3020; Email: dnf@med.pitt.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 13 Nov 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 VASC ENDOVASCULAR SURGHome page
B. B. Lee, Y. W. Kim, J. M. Seo, J. H. Hwang, Y. S. Do, D. I. Kim, H. S. Byun, S. K. Lee, S. H. Huh, and W. S. Hyun
Current Concepts in Lymphatic Malformation
Vascular and Endovascular Surgery, January 1, 2005; 39(1): 67 - 81.
[Abstract] [PDF]

Home page
 J. Med. Genet.Home page
A L Evans, R Bell, G Brice, P Comeglio, C Lipede, S Jeffery, P Mortimer, M Sarfarazi, and A H Child
Identification of eight novel VEGFR-3 mutations in families with primary congenital lymphoedema
J. Med. Genet., September 1, 2003; 40(9): 697 - 703.
[Full Text] [PDF]

Home page
 Physiol. Rev.Home page
L. Jussila and K. Alitalo
Vascular Growth Factors and Lymphangiogenesis
Physiol Rev, July 1, 2002; 82(3): 673 - 700.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
G Brice, S Mansour, R Bell, J R O Collin, A H Child, A F Brady, M Sarfarazi, K G Burnand, S Jeffery, P Mortimer, et al.
Analysis of the phenotypic abnormalities in lymphoedema-distichiasis syndrome in 74 patients with FOXC2 mutations or linkage to 16q24
J. Med. Genet., July 1, 2002; 39(7): 478 - 483.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
G. Oliver and M. Detmar
The rediscovery of the lymphatic system: old and new insights into the development and biological function of the lymphatic vasculature
Genes & Dev., April 1, 2002; 16(7): 773 - 783.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. F. Wang, X.-F. Zhang, and J. E. Groopman
Stimulation of beta 1 Integrin Induces Tyrosine Phosphorylation of Vascular Endothelial Growth Factor Receptor-3 and Modulates Cell Migration
J. Biol. Chem., November 2, 2001; 276(45): 41950 - 41957.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. J. Karkkainen, A. Saaristo, L. Jussila, K. A. Karila, E. C. Lawrence, K. Pajusola, H. Bueler, A. Eichmann, R. Kauppinen, M. I. Kettunen, et al.
A model for gene therapy of human hereditary lymphedema
PNAS, October 5, 2001; (2001) 221449198.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
M. S. Bray, J. Krushkal, L. Li, R. Ferrell, S. Kardia, C. F. Sing, S. T. Turner, and E. Boerwinkle
Positional Genomic Analysis Identifies the {beta}2-Adrenergic Receptor Gene as a Susceptibility Locus for Human Hypertension
Circulation, June 27, 2000; 101(25): 2877 - 2882.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Veikkola, M. Karkkainen, L. Claesson-Welsh, and K. Alitalo
Regulation of Angiogenesis via Vascular Endothelial Growth Factor Receptors
Cancer Res., January 1, 2000; 60(2): 203 - 212.
[Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. J. Karkkainen, A. Saaristo, L. Jussila, K. A. Karila, E. C. Lawrence, K. Pajusola, H. Bueler, A. Eichmann, R. Kauppinen, M. I. Kettunen, et al.
A model for gene therapy of human hereditary lymphedema
PNAS, October 23, 2001; 98(22): 12677 - 12682.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (82)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ferrell, R. E.
Right arrow Articles by Finegold, D. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrell, R. E.
Right arrow Articles by Finegold, D. N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?