The Wilms' tumor gene WT1 plays a key role in genitourinary development and subsequent normal function. Homozygous mutations of WT1 can be found in ~15% of Wilms' tumors. Furthermore, somatic heterozygous loss of WT1 is known to lead to cryptorchidism and hypospadias in males. A much more severe phenotype is seen in patients with Denys-Drash syndrome which results from heterozygous dominant-negative mutations of the gene. Characteristic features are mesangial sclerosis with early kidney failure, varying degrees of gonadal dysgenesis and high risk of Wilms' tumors. Here we show that a related disease, Frasier syndrome, characterized by focal glomerular sclerosis, delayed kidney failure and complete gonadal dysgenesis, is probably caused by specific intronic point mutations of WT1 that preferentially affect a CpG dinucleotide. Disruption of alternative splicing at the exon 9 splice donor site prevents synthesis of the usually more abundant WT1+KTS isoform from the mutant allele. In contrast to Denys-Drash syndrome, no mutant protein is produced. The splice mutation leads to an imbalance of WT1 isoforms in vivo, as detected by RT-PCR on streak gonadal tissue. Thus, WT1 isoforms must have quite different functions, and the pathology of Frasier syndrome suggests that especially gonadal development may be particularly sensitive to imbalance or relative underrepresentation of the WT1+KTS isoform.
The WT1 gene originally was isolated as a Wilms' tumor suppressor gene (1,2). Since it is mutated in no more than 15% of Wilms' tumors, other genes probably play a more important role in this tumor type (3,4). The gene encodes a nuclear zinc finger protein that can bind to DNA, and it is thought to function as a transcriptional regulator. Numerous genes have been proposed as targets for WT1, but the physiological relevance of these observations remains unclear (5).
The WT1 gene is alternatively spliced yielding four isoforms (6,7). This affects exon 5 (±17 amino acids) and an alternative splice donor site at the end of exon 9, leading to the presence or absence of the tripeptide sequence KTS between zinc fingers 3 and 4. The +KTS and -KTS forms of WT1 show different, but partly overlapping DNA-binding specificities (8). In transient transfection assays with reporters containing putative target gene promoters, these differences could be verified to a varying extent. However, WT1 may function not only as a transcriptional regulator since specific RNA binding and co-localization with nuclear splicing factor have been demonstrated (9-11).
The importance of normal WT1 function in development and growth control has been well documented. Knockout mice fail to develop kidneys due to massive apoptosis of metanephrogenic mesenchyme (12). They also show additional defects of mesothelia, heart and lungs, absence of gonadal development and they die around day 14 of gestation. Negative growth regulatory potential is evident from the observation that WT1 expression can significantly reduce tumor formation of G401 Wilms' tumor cells in nude mice (13). In several cell types, introduction of WT1 leads to increased apoptosis (14,15).
Gene dosage of WT1 is critical especially for male development. A heterozygous loss of WT1 as seen in WAGR syndrome patients leads to hypospadias and cryptorchidism (16). No genitourinary anomaly has been described for female individuals with WT1 hemizygosity.
Dominant-negative mutations of WT1 as seen in Denys-Drash syndrome show a much more dramatic phenotype (17). Effective WT1 levels in cells are probably reduced below 50% since WT1 protein can dimerize, resulting in abundant non-functional homo- and heterodimers of mutant WT1 protein (18). Kidney function is severely impaired through diffuse mesangial sclerosis, leading to nephrotic syndrome and kidney failure within the first 2 or 3 years of life in most cases (19). Gonadal development is disturbed to varying degrees. The most frequent diagnoses are 46 XY pseudohermaphrodites.
Frasier syndrome has been distinguished from Denys-Drash syndrome by Moorthy et al. (20) who established that there are clear differences in gonadal dysgenesis, progression of kidney disease and tumor risk. Initial attempts to find WT1 mutations in Frasier patients failed since only exons were scanned at that time (21). Re-analysis of published patients and extension of this work has now provided clear evidence that Frasier syndrome is caused by mutations of the alternative splice donor site of exon 9.
Genomic DNA from patients Che, Mar, Del, ws130, ws131 and DG could be isolated from blood cells. For ws130B, only paraffin embedded DNA from a colon tumor biopsy and DNA from a fibroblast cell line were available. Exon 9 of the WT1 gene could be amplified reliably, and PCR products were sequenced directly without intermediate cloning steps. Possible cross-contamination of samples was ruled out by genotyping samples with the highly polymorphic marker D11S533 (11q13).
Direct sequencing revealed a double band at the start of intron 9 at position +4 in patients Del, Mar, Che and ws130 (Fig. 1, Table 1). Instead of C alone, two nucleotides, T and C, could be read with equal intensity. Thus, the DNA is heterozygous for a C -> T point mutation in intron 9. This mutation has not been described before. Scanning of the WT1 sequence for possible splice donor sites with the program HSPL (http://www-hgc.lbl.gov/projects/splice.html) identified both splice donor sites at the end of exon 9. In the +4 mutant sequence, the second splice donor site had a markedly reduced score of 0.55 instead of 0.76 for the normal sequence. It is likely that this severely impairs the use of the second alternative splice donor site, like the +5 G -> A mutation described previously (22). Exactly the same +5 G -> A mutation was detected-again in heterozygous form-in patient DG who presented with typical Frasier syndrome (Table 1).
Eight patients with Frasier syndrome have been analyzed in the present study. In all cases, heterozygous mutations of the second alternative splice donor site of exon 9 were found. In addition to the previously described +5 G -> A mutation, a +4 C -> T mutation was detected. Available data suggest that the phenotypic consequences of both mutations are indistinguishable. The fact that WT1 intron 9 mutations were detected in all cases studied provides strong evidence that these mutations represent the molecular cause of Frasier syndrome.
The +5 G -> A mutation in patient JA has been described before, but the patient was classified as having Denys-Drash syndrome at that time (25). The similarity of clinical and molecular features of all Frasier patients listed in Table 1 suggests, however, that a re-classification would be appropriate. Similarly, two other cases (CS and VM) with WT1 exon 9 splice mutations may in fact have Frasier syndrome (22,26). Neither patient developed Wilms' tumor and they had glomerular sclerosis and complete gonadal dysgenesis with streak gonads. Renal failure in VM only occurred at 16 years of age, unusually late for Denys-Drash syndrome. All clinical data are thus compatible with Frasier syndrome (see Tables 0 and 2).
While this manuscript was under review, two other groups reported on WT1 mutations in eight additional patients with Frasier syndrome (27,28). Two new mutation sites at positions +2 and +6 of intron 9 could be found, and all results are in agreement with the present study. Even after merging all data, there is still a striking bias in the distribution of mutations: 15 of the 18 cases analyzed to date show the +4 C -> T and +5 G -> A mutations. This mutation hotspot probably results from the potential to deaminate 5-methylcytosine at the +4/+5 CpG dinucleotide.
The presence of alternative splice site mutations in Frasier syndrome highlights the importance of a precisely balanced expression of WT1 isoforms for its correct function. The +5 G -> A mutation has been shown previously to abolish alternative splicing in transient transfections using minigene constructs (22). Although such tests have not been done for the +4 C -> T mutation, it can be anticipated that this mutation will also affect alternative splicing as predicted by computer programs. Importantly, we have been able to demonstrate altered WT1 isoform ratios in vivo through an RT-PCR analysis of tissues expressing WT1. The ratio of +/-KTS isoforms in kidney or Wilms' tumors was in the range 1.5-2.8, which is identical to values obtained by other laboratories (6,29). In contrast, two samples of gonadal or tumor tissue from Frasier patients showed altered ratios of WT1 isoforms, with a ratio of ~0.5. Very similar results have been obtained by semi-quantitative RT-PCR with lymphocyte RNA from two patients with +4 C -> T and +6 T -> A mutations (27). Since the WT1 protein can dimerize (18), inversion of the +/-KTS ratio from ~2:1 to 1:2 will have an even stronger effect on the levels of WT1 +KTS and -KTS homodimers. In particular, the concentration of WT1 +KTS homodimers will decrease dramatically.
In this context, it is important to keep in mind that WT1 can be expressed from only one allele-at least in placenta and brain of some individuals (30). If such a silencing of one WT1 allele occurred in some of the terminally differentiated cells, for example in non-dividing podocytes of the kidney, it is conceivable that cells with active mutant WT1 cannot produce any WT1+KTS protein at all. This is of importance for the disease mechanism, and it would be interesting in future to assess allele-specific expression in affected cell types at the single cell level.
Since Frasier and Denys-Drash syndromes show partial clinical overlap it is worthwhile delineating specific characteristics for each disorder. Table 2 builds upon a previous classification by Moorthy et al. (20) and includes new data from genetic analyses that may explain differences in clinical presentation and disease course. The invariable presence of complete gonadal dysgenesis in all 46 XY Frasier patients suggests that the correct ratio of WT1 isoforms is absolutely critical for male gonadal development. On the other hand, the dominant-negative mutations seen in Denys-Drash syndrome may be variably permissive for male development, resulting in a broad spectrum of intersex and hermaphrodite phenotypes in karyotypic males. It should be noted that in individuals with a 46 XX karyotype gonadal development is generally less impaired or even normal (31).
The opposite situation is seen for kidney pathology. While Denys-Drash syndrome cases develop early nephrotic syndrome and renal failure, this only happens much later and over a longer period of time in Frasier syndrome. Histological findings are also different-diffuse mesangial sclerosis with expansion of mesangial matrix and subcapsular atrophy and immaturity (Denys-Drash) instead of focal glomerular sclerosis affecting only a fraction of glomeruli or segments of glomerular tufts (Frasier). It is also interesting that WAGR deletion patients with only one functional WT1 allele (50% WT1 function) have not been reported to have any impairment of kidney function, although hypospadias and cryptorchidism are clearly present in males.
The type of WT1 mutation also has significant impact on the tumor risk in Frasier and Denys-Drash syndrome. In the latter, the dominant-negative mutant allele is defective and loss of the second allele-according to the two-hit model-may be the most important step in tumor formation already. In contrast, Frasier patients have one normal copy of WT1 and one which can only produce the shorter isoform. Allele loss would thus lead to cells that cannot produce the +KTS isoform of WT1, but still have large amounts of the -KTS isoform. In this respect, it is interesting to note that tumorigenicity of the G401 Wilms' tumor cell line in nude mice can be suppressed by +KTS and -KTS isoforms to the same extent (13). This may explain why Frasier syndrome mutations apparently do not increase the risk of Wilms' tumor.
On the other hand, there is a high frequency of gonadoblastomas in Frasier patients (20). This may be due to the obligatory presence of streak gonads which carry a high risk of malignancy. The rather low incidence of gonadoblastoma in Table 1 may be due in part to prophylactic gonadectomy. In Denys-Drash syndrome, there are fewer cases of streak gonads with concomitantly lower incidence of gonadoblastoma. There may, however, still be differences in the state at which gonadal development is halted, resulting in further modulation of tumor risk.
Transmission to multiple offspring may not be uncommon in Frasier syndrome. The sisters ws131 and ws131B have the same mutation and a similar course of kidney disease. Transmission to a third female child in the same family appears likely, although the onset of kidney disease at 6 months with failure around age 2 is not typical (23). Interestingly, there are only two reports of possible 46 XX Frasier patients, one of them being patient ws131 who appears to have little if any problems of gonadal development. A second case has been described by Bailey et al. (24), but DNA was not available for study. The authors describe primary hypogonadism and sexual infantilism in their patient. This is completely different from our case and may suggest that the patient described by Bailey et al. may not have Frasier syndrome. The paucity of 46 XX karyotypes reported may be due to underdiagnosis as these patients suffer primarily from nephrotic syndrome and kidney failure. Since females may in general have much reduced or missing gonadal problems, the correct diagnosis could be missed. The highly specific mutations detected in all cases presented may provide a facile way to identify these patients in dialysis and transplant units.
Genomic DNA from white blood cells was purified by phenol/chloroform extraction and ethanol precipitation as described previously (3). From paraffin-embedded material, ten 5 µm sections were used for DNA extraction according to standard procedures (32). Briefly, sections were directly incubated in 200 µl of lysis buffer (50 mM Tris, pH 8, 1 mM EDTA, 0.5% Tween-20 and 200 µg/ml proteinase K) at 65°C overnight, followed by boiling for 10 min with 100 µl of Chelex 100 slurry. After centrifugation, the aqueous phase was stored at -20°C.
Amplification of WT1 exon 9 was carried out with intronic primers WT9S (cattgttagggccgaggcta) and WT9A (cttttccaatccctctcatca) (3) and 50 ng of blood DNA or 1 µl of DNA purified from section material using standard conditions (30-40 cycles, 60°C annealing and 30 s each for denaturation, annealing and extension steps). In cases of low yield from section material, a reamplification for 15 cycles with hemi-nested primers DDS1 (gcgaaagttctcccggtcc) and WT9A was performed. PCR products were run on agarose gels and purified with Nucleotrap matrix (Macherey & Nagel, Düren, Germany). Direct sequence analysis was carried out with primers WT9A (antisense) and DDS1 (sense) using the ThermoSequenase [33P]dideoxy-terminator kit (Amersham).
For microsatellite analysis, primer sequences and PCR conditions were taken from GDB. Products were visualized by [32P]dCTP incorporation and autoradiography after separation on sequencing gels for the WT1 (CA)n repeat (7). The D11S533 repeat could be analyzed directly by agarose gel electrophoresis.
For paraffin-embedded archival specimens, a nucleic acid extraction protocol described by O'Driscoll et al. (33) was used. Ten 5 µm sections were deparaffinized with xylene and ethanol, air dried and suspended in 200 µl of digestion buffer (10 mM Tris, pH 8, 100 mM NaCl, 25 mM EDTA, 0.5% SDS and 100 µg/ml proteinase K). After digestion for 16 h at 50°C, total nucleic acids were extracted by phenol/chloroform extractions and subsequent ethanol precipitation. The nucleic acid pellet was resuspended in 100 µl of water. RT-PCR was performed on duplicate samples using the Boehringer Mannheim Titan one tube RT-PCR kit according to the instructions supplied (single tube reaction with 30 min cDNA synthesis, followed by 35 cycles of PCR). Primers were Fras-1 (ccagctcaaaagacaccaaag, exon 8) and Fras-2 (tttctgacaacttggccacc, exon 10). To quantitate WT1 splice isoforms, a second round of hemi-nested PCR with primers DDS1 and Fras-2 and 0.1 µl of the first PCR reaction was performed with 15 cycles and addition of [32P]dCTP. Products were separated on a non-denaturing polyacrylamide gel, dried and exposed to X-ray film. Quantitation was performed on a Molecular Dynamics Phospho-Imager.
The authors would like to thank the patients involved in this study. We are grateful to Professors R. Dumas, C. Marty-Double, C. Angle, Drs M. Malone, J. Miller, M. Nolte, L. Rees and L. Roffman, and Ms D. Kuntzelman for providing specimens or clinical information. A.K. is funded by the Twistington Higgins Research Fellowship from the National Kidney Research Fund. This work was funded by grants from the Deutsche Forschungsgemeinschaft (Ge539-3/8).
*To whom correspondence should be addressed. Tel: +49 931 888 4159; Fax: +49 931 888 4150; Email: gessler@biozentrum.uni-wuerzburg.de
Human Molecular Genetics
Pages
Introduction
Results
WT1 intron 9 mutation in familial Frasier syndrome
The WT1 intron 9 mutation affects alternative splicing in vivo
Discussion
Materials And Methods
Isolation of DNA and direct sequencing
RT-PCR analysis
Acknowledgements
References
Table 2
REFERENCES
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 14 Mar 1998
Copyright© Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Lowik, E. Levtchenko, D. Westra, P. Groenen, E. Steenbergen, J. Weening, M. Lilien, L. Monnens, and L. v. d. Heuvel Bigenic heterozygosity and the development of steroid-resistant focal segmental glomerulosclerosis Nephrol. Dial. Transplant., October 1, 2008; 23(10): 3146 - 3151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Morrison, R. L. Viney, M. A. Saleem, and M. R. Ladomery New insights into the function of the Wilms tumor suppressor gene WT1 in podocytes Am J Physiol Renal Physiol, July 1, 2008; 295(1): F12 - F17. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Waters, M. Y.J. Wu, T. Onay, J. Scutaru, J. Liu, C. G. Lobe, S. E. Quaggin, and T. D. Piscione Ectopic Notch Activation in Developing Podocytes Causes Glomerulosclerosis J. Am. Soc. Nephrol., June 1, 2008; 19(6): 1139 - 1157. [Full Text] [PDF]
|
|
|
|
|
|
L. He, Y. Sun, M. Takemoto, J. Norlin, K. Tryggvason, T. Samuelsson, and C. Betsholtz The Glomerular Transcriptome and a Predicted Protein-Protein Interaction Network J. Am. Soc. Nephrol., February 1, 2008; 19(2): 260 - 268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Klattig, R. Sierig, D. Kruspe, B. Besenbeck, and C. Englert Wilms' Tumor Protein Wt1 Is an Activator of the Anti-Mullerian Hormone Receptor Gene Amhr2 Mol. Cell. Biol., June 15, 2007; 27(12): 4355 - 4364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. A. Schumacher, S. Jeruschke, F. Eitner, J. U. Becker, G. Pitschke, Y. Ince, J. H. Miner, I. Leuschner, R. Engers, A. S. Everding, et al. Impaired Glomerular Maturation and Lack of VEGF165b in Denys-Drash Syndrome J. Am. Soc. Nephrol., March 1, 2007; 18(3): 719 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Chisa and D. T. Burke Mammalian mRNA Splice-Isoform Selection Is Tightly Controlled Genetics, March 1, 2007; 175(3): 1079 - 1087. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Bor, J. Swartz, A. Morrison, D. Rekosh, M. Ladomery, and M.-L. Hammarskjold The Wilms' tumor 1 (WT1) gene (+KTS isoform) functions with a CTE to enhance translation from an unspliced RNA with a retained intron Genes & Dev., June 15, 2006; 20(12): 1597 - 1608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Simpson, E. A. Burwell, K. A. Thompson, S. Shahnaz, A. R. Chen, and D. M. Loeb The antiapoptotic gene A1/BFL1 is a WT1 target gene that mediates granulocytic differentiation and resistance to chemotherapy Blood, June 15, 2006; 107(12): 4695 - 4702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Benz, C. Plank, K. Amann, B. Mucha, H. G. Dorr, W. Rascher, and J. Dotsch Hypergonadotropic hypogonadism and renal failure due to WT1 mutation Nephrol. Dial. Transplant., June 1, 2006; 21(6): 1716 - 1718. [Full Text] [PDF]
|
|
|
|
 |
|
 K. Tryggvason, J. Patrakka, and J. Wartiovaara Hereditary proteinuria syndromes and mechanisms of proteinuria. N. Engl. J. Med., March 30, 2006; 354(13): 1387 - 1401. [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Smolen, M. T. Vassileva, J. Wells, M. J. Matunis, and D. A. Haber SUMO-1 Modification of the Wilms' Tumor Suppressor WT1 Cancer Res., November 1, 2004; 64(21): 7846 - 7851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Little, S. P. Hanks, L. King-Underwood, C. Jones, E. A. Rapley, N. Rahman, and K. Pritchard-Jones Frequency and Heritability of WT1 Mutations in Nonsyndromic Wilms' Tumor Patients: A UK Children's Cancer Study Group Study J. Clin. Oncol., October 15, 2004; 22(20): 4140 - 4146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Discenza and J. Pelletier Insights into the physiological role of WT1 from studies of genetically modified mice Physiol Genomics, February 13, 2004; 16(3): 287 - 300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Davies, M. Ladomery, P. Hohenstein, L. Michael, A. Shafe, L. Spraggon, and N. Hastie Development of an siRNA-based method for repressing specific genes in renal organ culture and its use to show that the Wt1 tumour suppressor is required for nephron differentiation Hum. Mol. Genet., January 15, 2004; 13(2): 235 - 246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Reynolds, G. A. Smolen, R. E. Palmer, D. Sgroi, V. Yajnik, W. L. Gerald, and D. A. Haber Identification of a DNA-binding site and transcriptional target for the EWS-WT1(+KTS) oncoprotein Genes & Dev., September 1, 2003; 17(17): 2094 - 2107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-D. Wagner, N. Wagner, and A. Schedl The complex life of WT1 J. Cell Sci., May 1, 2003; 116(9): 1653 - 1658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ladomery, J. Sommerville, S. Woolner, J. Slight, and N. Hastie Expression in Xenopus oocytes shows that WT1 binds transcripts in vivo, with a central role for zinc finger one J. Cell Sci., April 15, 2003; 116(8): 1539 - 1549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Pollak Inherited Podocytopathies: FSGS and Nephrotic Syndrome from a Genetic Viewpoint J. Am. Soc. Nephrol., December 1, 2002; 13(12): 3016 - 3023. [Full Text] [PDF]
|
|
|
|
|
|
D. Wilhelm and C. Englert The Wilms tumor suppressor WT1 regulates early gonad development by activation of Sf1 Genes & Dev., July 15, 2002; 16(14): 1839 - 1851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. F. S. Melo, R. M. Martin, E. M. F. Costa, F. M. Carvalho, A. A. Jorge, I. J. P. Arnhold, and B. B. Mendonca An Unusual Phenotype of Frasier Syndrome due to IVS9 +4C>T Mutation in the WT1 Gene: Predominantly Male Ambiguous Genitalia and Absence of Gonadal Dysgenesis J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2500 - 2505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Basciani, S. Mariani, M. Arizzi, S. Ulisse, N. Rucci, E. A. Jannini, C. D. Rocca, A. Manicone, C. Carani, G. Spera, et al. Expression of Platelet-Derived Growth Factor-A (PDGF-A), PDGF-B, and PDGF Receptor-{alpha} and -{beta} during Human Testicular Development and Disease J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 2310 - 2319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rossetti, S. Burton, L. Strmecki, G. R. Pond, J. L. San Millan, K. Zerres, T. M. Barratt, S. Ozen, V. E. Torres, E. J. Bergstralh, et al. The Position of the Polycystic Kidney Disease 1 (PKD1) Gene Mutation Correlates with the Severity of Renal Disease J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1230 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. MROWKA and A. SCHEDL Wilms' Tumor Suppressor Gene WT1: From Structure to Renal Pathophysiologic Features J. Am. Soc. Nephrol., November 1, 2000; 11(90002): 106S - 115. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. H. Laity, H. J. Dyson, and P. E. Wright Molecular basis for modulation of biological function by alternate splicing of the Wilms' tumor suppressor protein PNAS, October 24, 2000; 97(22): 11932 - 11935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bonte, W. Schroder, E. Denamur, and U. Querfeld Absent pubertal development in a child with chronic renal failure: the case of Frasier syndrome Nephrol. Dial. Transplant., October 1, 2000; 15(10): 1688 - 1690. [Full Text] [PDF]
|
|
|
|
 |
|
 D. Baudry, M. Hamelin, M.-O. Cabanis, J.-C. Fournet, M.-F. Tournade, S. Sarnacki, C. Junien, and C. Jeanpierre WT1 Splicing Alterations in Wilms' Tumors Clin. Cancer Res., October 1, 2000; 6(10): 3957 - 3965. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. TAKATA, H. KIKUCHI, R. FUKUZAWA, S. ITO, M. HONDA, and J.-I. HATA Constitutional WT1 mutations correlate with clinical features in children with progressive nephropathy J. Med. Genet., September 1, 2000; 37(9): 698 - 701. [Full Text]
|
|
|
|
|
|
R. C. Davies, E. Bratt, and N. D. Hastie Did nucleotides or amino acids drive evolutionary conservation of the WT1 {+/-}KTS alternative splice? Hum. Mol. Genet., May 1, 2000; 9(8): 1177 - 1183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Scharnhorst, P. Dekker, A. J. van der Eb, and A. G. Jochemsen Physical Interaction between Wilms Tumor 1 and p73 Proteins Modulates Their Functions J. Biol. Chem., March 31, 2000; 275(14): 10202 - 10211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Ladomery, J. Slight, S. Mc Ghee, and N. D. Hastie Presence of WT1, the Wilm's Tumor Suppressor Gene Product, in Nuclear Poly(A)+ Ribonucleoprotein J. Biol. Chem., December 17, 1999; 274(51): 36520 - 36526. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. DEMMER, W. PRIMACK, V. LOIK, R. BROWN, N. THERVILLE, and K. MCELREAVEY Frasier Syndrome: A Cause of Focal Segmental Glomerulosclerosis in a46,XX Female J. Am. Soc. Nephrol., October 1, 1999; 10(10): 2215 - 2218. [Abstract] [Full Text]
|
|
|
|
|
|
J. Kim, D. Prawitt, N. Bardeesy, E. Torban, C. Vicaner, P. Goodyer, B. Zabel, and J. Pelletier The Wilms' Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation Mol. Cell. Biol., March 1, 1999; 19(3): 2289 - 2299. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||