Human Molecular Genetics

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (109) Request Permissions Google Scholar Articles by Oka, A. Articles by Inoko, H. Search for Related Content PubMed PubMed Citation Articles by Oka, A. Articles by Inoko, H. Social Bookmarking          What's this?

Human Molecular Genetics

Pages 2165-2170

©1999 Oxford University Press

---

Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene
Introduction
Results
Discussion
Materials And Methods
   Patients
   Genotyping for microsatellite alleles
   Statistical analysis
Acknowledgements
References

---

Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene

Akira Oka, Gen Tamiya, Maiko Tomizawa, Masao Ota², Yoshihiko Katsuyama³, Satoshi Makino, Takashi Shiina, Mai Yoshitome⁴, Mariko Iizuka¹, Yuki Sasao¹, Kenichi Iwashita¹, Yo Kawakubo¹, Junichi Sugai¹, Akira Ozawa¹, Muneo Ohkido¹, Minoru Kimura, Seiamak Bahram⁵, Hidetoshi Inoko⁺

Department of Genetic Information, Division of Molecular Life Science and ¹Department of Dermatology, Tokai University School of Medicine, Bohseidai, Isehara, Kanagawa 259-1193, Japan, ²Department of Legal Medicine and ³Department of Pharmacy, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-0802, Japan, ⁴Department of Biology, Kitasato University, School of Science, 1-15-1 Kitasato, Sagamihara, Kanagawa 228-8555, Japan and ⁵Centre de Recherche d'Immunologie et d'Hematologie, 4 rue Kirschleger, 67085 Strasbourg Cedex, France

Received June 3, 1999; Revised and Accepted August 30, 1999

DDBJ/EMBL/GenBank accession nos AB029331 and AB031479-AB031481

The HLA-Cw6 antigen has been associated with psoriasis vulgaris despite racial and ethnic differences. However, it remains unclear whether it is the HLA-Cw6 antigen itself or a closely linked, hitherto unidentified, locus that predisposes to the disease. Here, in order to map the susceptibility locus for psoriasis vulgaris precisely within the HLA class I region, 11 polymorphic microsatellite markers distributed throughout a 1060 kb segment surrounding the HLA-C locus were subjected to association analysis in Japanese psoriasis vulgaris patients. Statistical analyses of the distribution and deviation from Hardy-Weinberg equilibrium of the allelic frequency at each microsatellite locus revealed that the pathogenic gene for psoriasis vulgaris is located within a reduced interval of 111 kb spanning 89-200 kb telomeric of the HLA-C gene. In addition to three known genes, POU5F1, TCF19 and S, this 111 kb fragment contains four new, expressed genes identified in the course of our genomic sequencing of the entire HLA class I region. Therefore, these seven genes are the potential candidates for susceptibility to psoriasis vulgaris.

INTRODUCTION

Psoriasis vulgaris (MIM 177900) is a common skin disorder characterized by inflammatory cell infiltration and hyperproliferation of epidermal cells. The familial nature of this disease, which affects almost 2% of Caucasian populations, has long been recognized. However, in the Japanese population, a lower incidence (0.1%) has been observed, with most psoriasis vulgaris cases being sporadic. These facts define psoriasis vulgaris as a multifactorial disease, triggered by the involvement of some environmental factors in individuals with a particular genetic background. In fact, recent genome-wide linkage studies have identified several susceptibility loci on chromosomes 6p21.3 [human leucocyte antigen (HLA)], 17q25, 4q and many others (1-4).

Among them, the HLA locus is believed to be one of the major genetic factors predisposing to disease. It is well known that psoriasis vulgaris is associated with several serologically defined HLA class I antigens such as HLA-B13, -B17, -B39, -B57, -Cw6 and -Cw7. This has been verified throughout the world, within many different populations, including Caucasians and Japanese (5-9). Among these alleles, the single most consistent and significant association is that of HLA-Cw6. However, this association is not as strong as that between HLA-B27 and ankylosing spondylitis (MIM 106300), where up to 100% of patients carry the allele which most probably is the bona fide causative element (10). Indeed, only 10% (Japanese) to 45% (Caucasians) of patients with psoriasis vulgaris carry the HLA-Cw6 allele (6,11). Therefore, the possibility clearly exists that the HLA-C gene itself is not the primary locus responsible for psoriasis vulgaris and that other gene(s) located nearby harbor the true pathogenic mutation/allele, in strong linkage disequilibrium with HLA-Cw6. In this respect, fine mapping of this putative susceptibility locus using high resolution genetic markers around the HLA-C gene is clearly needed.

We recently have accomplished sequence analysis of the entire 1.8 Mb HLA class I region from MICB (major histocompatibility complex class I chain-related gene B) to HLA-F and have identified >40 new genes within this segment (12-14). Concentrating on our target fragment, a total of 11 novel highly polymorphic microsatellite markers located at regular intervals in the region surrounding HLA-C were selected for high resolution mapping of the putative major histocompatibility complex (MHC)-linked `psoriasis gene'.

RESULTS

During the course of our large-scale genomic sequencing, 758 microsatellite loci ranging from di- to penta-nucleotide repeats were identified within the 1.8 Mb HLA class I region, which extends from the centromeric MICB gene to the telomeric HLA-F gene (12-15) and hence includes the HLA-B and -C genes. Among these microsatellites, 70 were characterized for their polymorphism content in the Japanese population. Of these, 38 were found to be highly informative with a PIC (polymorphism content) value of 0.66 and an average of 8.9 alleles (15,16). Here, we have selected 11 microsatellites which were densely distributed at a resolution of one microsatellite per ~100 kb around the HLA-C locus (C1_2_A, 232 kb centromeric; C1_4_1, 91 kb centromeric; C1_2_5, 19 kb centromeric; C1_4_3, 29 kb telomeric; C1_3_1, 31 kb telomeric; C1_2_6, 89 kb telomeric; C1_3_2, 143 kb telomeric; C2_4_4, 200 kb telomeric; C4_2_12, 457 kb telomeric; C4_2_25, 618 kb telomeric; and C3_2_11, 831 kb telomeric) (Fig. 1).

Figure 1. P-values obtained by the association test and the exact test of Hardy-Weinberg proportion with the locations of microsatellite markers used for gene mapping of psoriasis vulgaris. ^aGene map showing the location of each gene in the HLA class I region from IkBL to HLA-L. Black and white boxes represent the HLA-class I genes and non-HLA genes, respectively. Arrows indicate the orientations of genes. ^bStatistical analysis by the case-control association test and the exact test of Hardy-Weinberg proportion. The curve is drawn as smoothly fitted on the basis of a two-point moving average in each test. Open circles with solid line, Pc-values obtained by Fisher's exact test in the case-control association test; open squares with dashed line, P-values obtained in the patients by the exact test in terms of deviation from Hardy-Weinberg proportions (the probability test); closed squares with bold solid line, P-values obtained in the patients by the exact test in terms of heterozygote deficiency against the null hypothesis of Hardy-Weinberg equilibrium. ^cLocations of microsatellite markers with the distance (kb) from the HLA-C locus to each microsatellite in parentheses.

A total of 76 Japanese patients with psoriasis vulgaris were enrolled for association analysis using these microsatellites. In the patients, the phenotype frequency of HLA-Cw6 (8/76 patients, 10.5%) was significantly increased, with a Pc-value of 0.02 (odds ratio = 15.88). As shown in Table 1, alleles showing statistically significant differences from the Pc-value of <0.05 in the patient group were found at four microsatellite loci: alleles 303 ([chi]² = 12.62, Pc = 0.0015) of C1_2_6; 357 ([chi]² = 7.91, Pc = 0.034) of C1_3_2; 255, 259 ([chi]² = 9.53, Pc = 0.012 and [chi]² = 11.58, Pc = 0.0022, respectively) of C2_4_4; and 223 ([chi]² = 7.59, Pc = 0.036) of C4_2_12. Alleles in each microsatellite marker were named on the basis of the amplified fragment size length. The most significant association was obtained for the 303 allele of the C1_2_6 locus. All four microsatellites in the segment from the loci C1_2_6 to C4_2_12 exhibited statistically significant differences in their allele frequencies between the patients and controls (Table 1 and Fig. 1).

Table 1. Statistically significant alleles associated with psoriasis vulgaris

Loci	Distance from HLA-Ca	No. of alleles	Allele	Odds ratio	CI of odds ratio	[chi]2	P-valueb	Pc-valuec
C1_2_A	232 kb (c)	10	242	0.44	0.24-0.81	6.97	0.0059	0.059
C1_4_1	91 kb (c)	5	221	0.59	0.31-1.11	2.66	0.069	0.345
C1_2_5	19 kb (c)	14	216	2.58	1.59-5.08	7.54	0.0057	0.0798
C1_4_3	29 kb (t)	17	467	0.16	0.04-0.59	7.52	0.0037	0.0629
C1_3_1	31 kb (t)	4	291	0.49	0.27-0.89	5.57	0.013	0.052
C1_2_6	89 kb (t)	8	303	0.21	0.09-0.5	12.62	0.00019	0.00152
C1_3_2	143 kb (t)	8	357	2.37	1.3-4.32	7.91	0.0042	0.0336
C2_4_4	200 kb (t)	6	255	2.76	1.45-5.25	9.53	0.002	0.012
C2_4_4			259	0.24	0.11-0.55	11.58	0.00037	0.00222
C4_2_12	457 kb (t)	9	223	0.33	0.73-0.15	7.59	0.004	0.036
C4_2_25	618 kb (t)	7	271	5.06	0.56-45.1	2.11	0.2	1
C3_2_11	831 kb (t)	17	209	0.55	0.26-1.17	2.43	0.082	1

^a(c), centromeric of the HLA-C gene; (t), telomeric of the HLA-C gene.
^bDetermined by Fisher's exact test.
^cCorrected by multiplying by the number of microsatellite alleles observed in each locus. Pc-values of <0.05 accepted as statistically significant are underlined.

The exact test of Hardy-Weinberg proportion was also carried out for these 11 microsatellite markers by the Markov chain method (17) in terms of deviation from Hardy-Weinberg proportions (the probability test) and heterozygote deficiency against the null hypothesis of Hardy-Weinberg equilibrium (18,19). All of the 11 markers tested followed, as expected, Hardy-Weinberg equilibrium in the healthy controls (P > 0.25). In contrast, five loci deviated significantly from Hardy-Weinberg equilibrium in the patients (P < 0.1: C1_2_5, C1_3_1, C1_2_6, C1_3_2 and C2_4_4). Furthermore, five loci showed a significant decrease in heterozygotes (P < 0.1: C1_4_3, C1_3_1, C1_3_2, C2_4_4 and C4_2_12), as listed in Table 2. On the other hand, heterozygote excess was not observed at any markers. It must be noted that the three microsatellite loci (C1_3_1, C1_3_2 and C2_4_4) in the segment from C1_3_1 to C2_4_4 displayed significant P-values in both probability and heterozygote deficiency tests (Table 2 and Fig. 1). In particular, C1_3_2 and C2_4_4 reached highly significant P-values for both of these tests.

Table 2. Exact test of the Hardy-Weinberg proportion of microsatellites

Loci	HWa	SE	Hetero.b	SE	Ex. hetero.c	Ob. hetero.d
C1_2_A	0.3939	0.0043	0.2881	0.0042	0.801	0.763
C1_4_1	0.2443	0.0016	0.7024	0.0019	0.633	0.613
C1_2_5	0.0063	0.0006	0.1599	0.0042	0.883	0.842
C1_4_3	0.1968	0.0065	0.0362	0.0028	0.89	0.829
C1_3_1	0.0286	-	0.0203	-	0.561	0.461
C1_2_6	0.0889	0.0023	0.1776	0.0027	0.676	0.579
C1_3_2	0.0172	0.0005	0.0051	0.0003	0.848	0.75
C2_4_4	0.0097	0.0004	0.0093	0.0003	0.655	0.553
C4_2_12	0.3006	0.0052	0.0303	0.0013	0.679	0.635
C4_2_25	0.666	0.0041	0.6684	0.007	0.466	0.481
C3_2_11	0.1837	0.0057	0.4787	0.0078	0.9	0.895

The exact P-value was estimated by the simulations based on the Markov chain method with the following parameters: dememorization number = 1000; no. of batches = 400; iteration per batch = 8000. When the number of alleles was <5, the exact P-value was calculated by the complete enumeration method. P-values of <0.1 accepted as statistically significant are underlined.
SE, standard error.
^aDeviation from Hardy-Weinberg proportions (probability test).
^bHeterozygote deficiency against the null hypothesis of Hardy-Weinberg equilibrium.
^cExpected heterozygote frequency in the patient population.
^dObserved heterozygote frequency in the patient population.

DISCUSSION

On completion of our genomic sequence determination of the entire 1.8 Mb HLA class I region, a total of 38 highly informative microsatellite repeats were selected for high resolution mapping. Combined with the seven previously known polymorphic genes and microsatellites [MICB, MICA, HLA-B, HLA-C, HLA-A, MIB (20) and D6S265 (21)], a total of 45 informative genetic markers, i.e. one every 41.1 kb, are defined within the HLA class I region. These high density polymorphic markers are expected to provide useful and precise information for haplotype and mapping analyses of HLA class I-associated diseases such as psoriasis vulgaris, Behçet's disease (MIM 109650), acute anterior uveitis and ulcerative colitis (MIM 191390).

In this study, to determine the definite position of the causative gene for psoriasis vulgaris within the HLA class I region, association analyses were conducted using 11 of these 38 repeats. Four of these microsatellites (C1_2_6, C1_3_2, C2_4_4 and C4_2_12) in the segment from C1_2_6 to C4_2_12 displayed statistically significant differentiation between the patients and controls (Table 1 and Fig. 1). Further, the Hardy-Weinberg equilibrium analyses in the patient group suggested that the three microsatellite loci (C1_3_1, C1_3_2 and C2_4_4) in the segment from C1_3_1 to C2_4_4 displayed significant deviation from Hardy-Weinberg equilibrium in both the probability and heterozygote deficiency tests (Table 2 and Fig. 1). In particular, C1_3_2 and C2_4_4 reached highly significant P-values for both tests. Although the mode of inheritance of psoriasis is unclear, the lower than expected frequency of heterozygotes at these five microsatellite loci in the patients (Table 1) may suggest a recessive HLA trait for this disease, although the genetic penetrance is not high. Collectively, it can be concluded that the 111 kb segment from C1_2_6 (89 kb telomeric of HLA-C) to C2_4_4 (200 kb telomeric of HLA-C) is the common area critical for psoriasis vulgaris at a >95% confidence level, as assessed by both statistical methods for allelic distribution and deviation from Hardy-Weinberg equilibrium (Fig. 1). It must be emphasized that these two independent statistical methods, of which the former deals with the data of patients and controls and the latter only with the data of patients, revealed an almost identical critical segment for psoriasis vulgaris. This result is consistent with previous mapping data showing that the susceptibility gene for psoriasis vulgaris resides on the telomeric side of the HLA-C gene, based on the transmission/disequilibrium test (TDT) and parametric linkage analysis using the HLA class I (HLA-A, -B and -C) and class II (HLA-DRB1 and -DQB1) alleles in the patients (22). Investigation of recombinant haplotypes in the HLA region revealed the presence of the five `frozen blocks' in which recombination rarely occurs, thus maintaining stable ancestral HLA haplotypes (23). Among them, the [beta]-block spans ~500 kb from the HLA-B-associated transcript 1 (BAT1) gene to the S gene. The telomeric boundary of this [beta]-block, where a hotspot for genetic recombination is supposed to operate, is in the region of the C2_4_4 locus and so may also define the telomeric end of the critical region for psoriasis vulgaris.

Within this defined critical region for psoriasis vulgaris, we have so far identified three known genes, POU5F1 (OTF3; octamer transcription factor 3) (24,25), TCF19 (SC1; cell growth-regulated gene) (25,26) and S (corneodesmosin gene) (27-30), two new, completely expressed sequence tag-matched expressed genes as well as two putative genes detected by RT-PCR (using keratinocyte mRNA). The S gene encodes a 52-56 kDa protein, corneodesmosin, which is expressed in differentiating epidermal keratinocytes. Given this, it is an obvious candidate for psoriasis vulgaris. However, our previous genetic analysis of polymorphic nucleotide positions 619 (Ser/Phe), 1240 (Gly/Val) and 1243 (Ser/Leu) failed to delineate any significant associations with the Japanese psoriasis vulgaris patients (28). This is in contrast to a reported notable disease association with Leu (allele 2) at position 1243 in Caucasian patients (29,30). Although the reason for this discrepancy remains unclear at present, there are three possible explanations. First, the number of patients enrolled in our study (28) was not sufficient (n = 63) to obtain statistical significance, as compared with those in Tazi et al. (n = 235) (29) and Allen et al. (n = 152) (30). Second, there is an unknown disease-causing allele or mutation in the S gene itself or in a nearby gene, which in turn is in linkage disequilibrium with allele 2 at position 1243 in Caucasian populations, but not in the Japanese population. Third, the pathogenic gene (or allele) is not identical in Japanese and Caucasian patients, which may indeed result in the observed differential clinical manifestations between two populations, e.g. the age of disease onset, the familial clustering, the incidence, the frequency of HLA-Cw6-carrying patients, etc. POU5F1 and TCF19 are two further other genes within the critical area. POU5F1 is expressed in totipotent and pluripotent stem cells of the pre-gastrulation embryo and plays a role in early development (23). The TCF19 gene is ubiquitously expressed in the G₁-S phases of the cell cycle as a cell growth regulatory factor. Based on these broadly based functions, neither POU5F1 nor TCF19 appear to be obvious candidates for the putative MHC-linked psoriasis vulgaris gene, although this needs to be ruled out formally.

One of the four new genes in the 111 kb critical region for psoriasis vulgaris is expressed in most of the tissues examined, including keratinocytes, and encodes a plectin-like protein with [alpha]-helical coiled-coil rod domains. Plectin has been proposed to provide mechanical strength to cells and tissues by acting as a cross-linking element of the cytoskeleton (31). Furthermore, it is of particular interest that the plectin gene is responsible for the development of epidermolysis bullosa simplex (32). The other three new genes have no homology to any known sequences in the DNA databases, although it is noteworthy that all of them are expressed specifically in keratinocytes and skin tissues. Thus, in addition to the S gene, these four new genes are also strong candidates for psoriasis vulgaris in terms of their expression pattern and/or predicted function. In this respect, it is of great importance to investigate disease-associated polymorphism(s)/mutation(s) within all these loci in several ethnically diverse patient and control populations.

MATERIALS AND METHODS

Patients

A total of 76 unrelated Japanese patients with psoriasis vulgaris and 132 healthy controls were investigated in this study. All patients were hospitalized for diagnosis and treatment at the Department of Dermatology, Tokai University School of Medicine (Kanagawa, Japan). The patient group consisted of 51 males and 25 females with mean age of onset of 33.9 years (SD = 15.3). Informed consent was obtained from all the healthy donors and patients by explaining the details of this study prior to collection of peripheral blood.

Genotyping for microsatellite alleles

To determine the number of repeat units of the microsatellite loci exhibiting polymorphisms, unilateral primers were synthesized by labeling at the 5[prime] end with the fluorescent reagent, 6-FAM, HEX or TET (PE Biosystems, Foster City, CA). PCR primers used for amplification of 11 microsatellites (C1_2_A, C1_4_1, C1_2_5, C1_4_3, C1_3_1, C1_2_6, C1_3_2, C2_4_4, C4_2_12, C4_2_25 and C3_2_11) are shown in Table 3. The PCR reaction mixture contained 50 ng of genomic DNA, 2 µl of dNTP (2.5 mM each), 2 µl of 10× buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15 mM MgCl₂) and 20 pmol of forward and reverse primers as well as 0.5 U of Takara recombinant Taq polymerase (Takara Shuzo, Kyoto, Japan) in a total volume of 20 µl. After initial denaturation for 5 min at 96°C, amplification was carried out in an automated thermal cycler (Takara Shuzo) for 30 cycles consisting of 1 min at 96°C, 30 s at 55°C and 45 s at 72°C, with a final extension of 4 min at 72°C. The amplified products were denatured for 5 min at 100°C, mixed with formamide-containing stop buffer, applied with a size standard marker of GS500 Tamra (PE Biosystems) to each lane and run on a 4% polyacrylamide denaturing sequencing gel containing 8 M urea in an automated DNA sequencer. Fragment sizes were determined automatically using the GeneScan software (PE Biosystems).

Table 3. Microsatellite markers used in the association study

Microsatellite	Localization	Repeat unit	PCR primers
C1_2_A	Tel. (0 kb)/MICB	(CA)23	CA: AATAGCCATGAGAAGCTATGTGGGGGAG
	Cen. (89 kb)/MICA		TG: CTACCTCCTTGCCAAACTTGCTGTTTGTG
C1_4_1	Tel. (40 kb)/MICA	(CAAA)6	CAAA: CGAGAACAACTGGCAGGACTG
	Cen. (6 kb)/HLA-B		TTTG: GACAGTCCTCATTAGCGCTGAGG
C1_2_5	Tel. (62 kb)/HLA-B	(CA)4AA(CA)20	CA: CAGTAGTAAGCCAGAAGCTATTAC
	Cen. (19 kb)/HLA-C		TG: AAGTCAAGCATATCTGCCATTTGG
C1_4_3	Tel. (26 kb)/HLA-C	(GGAA)18	GGAA: TAGAAAACGCAATCTCGGCC
	Cen. (71 kb)/OTF3		TTCC: CTGGATTAACCTGGAGACTC
C1_3_1	Tel. (27 kb)/HLA-C	(TTG)8	TTG: CAGTGACAAGCACCTGGCAC
	Cen. (69 kb)/OTF3		CAA: GCCAGATGTGGTGGCATGC
C1_2_6	Tel. (85 kb)/HLA-C	(TA)17	TA: TGTTCAGACCTCTTCCTGCC
	Cen. (11 kb)/OTF3		AT: GACTAGCTCTTGACTACTTG
C1_3_2	Tel. (37 kb)/OTF3	(TAA)16	TAA: TAGGGATGGTCCCAAACGTG
	Cen. (7 kb)/S		TTA: CCCGTGCAGGACTGATCTCC
C2_4_4	Tel (80 kb)/S	(GAAA)6AAAA(GAAA)3	GAAA: GGCTTGACTTGAAACTCAGAGACC
			TTTC: TTATCTACTTATAGTCTATCACGG
C4_2_12	Tel. (75 kb)/DDR	(CA)13	CA: GAGCCACGGAGAGTCTCCCTTTATC
	Cen. (89 kb)/TUBB		TG: TCCAGGAACTGTGAGTAGTAAGAAC
C4_2_25	Tel. (69 kb)/TUBB	(TG)16	TG: TCTTCTGTGCAAGCAATGCACTGTAC
	Cen. (47 kb)/HSGT260		CA: ATGTTACTTTTAGAAGATAACACTC
C3_2_11	Tel. (50 kb)/HLA-E	(GA)22TA(GA)8	GA: AGATGGCATTTGGAGAGTGCAG
	Cen. (21 kb)/MICC		TC: TCCTTACAGCAGAGATATGTGG

Marker order from centromere to telomere is C1_2_A, C1_4_1, C1_2_5, C1_4_3, C1_3_1, C1_2_6, C1_3_2, C2_4_4, C4_2_12, C4_2_25 and C3_2_11 (Fig. 1). Repeat units are determined from our sequencing data (14). All markers were established by Tamiya et al. (15,16).
Tel., telomeric; Cen., centromeric.

Statistical analysis

Allele frequencies were estimated by direct counting. The significance of the distribution of alleles between the patients and the controls was tested by the [chi]² method with the continuity correction and Fisher's exact probability test (P-value test). The P-value was corrected by multiplying by the number of microsatellite alleles observed in each locus (Pc). A level of Pc < 0.05 was accepted as statistically significant. The odds ratio of the risk of psoriasis vulgaris was calculated from the 2 × 2 contingency table. The exact P-value test of the Hardy-Weinberg proportion for multiple alleles was simulated by the Markov chain method within the Genepop software package (15-17). The Markov chain method has the advantage of giving a complete enumeration for testing the Hardy-Weinberg proportion in cases where the number of alleles as well as sample size are small. When the number of alleles was <5, the exact P-value was calculated by the complete enumeration method. A level of P < 0.1 was accepted as statistically significant for the Hardy-Weinberg equilibrium test.

ACKNOWLEDGEMENTS

We would like to thank Naruse Taeko and Yumiko Matsuzawa for HLA genotyping, and Takako Sakuma and Setsuko Harada for secretarial assistance. We also wish to acknowledge the many helpful suggestions by Koji Watanabe and Masaaki Yamazaki at Fujiya Co. Ltd. This work was supported by a grant from the Japan Science and Technology Corp., an arm of the Japan Science and Technology Agency. S.B. and H.I. are grateful to a French-Japanese collaborative grant awarded jointly by INSERM and JSPS.

REFERENCES

1. Tomfohrde, J., Silverman, A., Barnes, R., Fernandez-Vina, M.A., Young, M., Lory, D., Morris, L., Wuepper, K.D., Stastny, P., Menter, A. and Bowcock, A. (1994) Gene for familial psoriasis susceptibility mapped to the distal end of human chromosome 17q. Science, 20, 1141-1145.

2. Matthews, D., Fry, L., Powles, A., Weber, J., McCarthy, M., Fisher, E., Davies, K. and Williamson, R. (1996) Evidence that a locus for familial psoriasis maps to chromosome 4q. Nature Genet., 14, 231-233. MEDLINE Abstract

3. Nair, R.P., Henseler, T., Jenisch, S., Stuart, P., Bichakjian, C.K., Lenk, W., Westphal, E., Guo, S.W., Christophers, E., Voorhees, J.J. and Elder, J.T. (1997) Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan. Hum. Mol. Genet., 6, 1349-1356. MEDLINE Abstract

4. Trembath, R.C., Clough, R.L., Rosbotham, J.L., Jones, A.B., Camp, R.D., Frodsham, A., Browne, J., Barber, R., Terwilliger, J., Lathrop, G.M. and Barker, J.N. (1997) Identification of a major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by a two stage genome-wide search in psoriasis. Hum. Mol. Genet., 6, 813-820. MEDLINE Abstract

5. Brenner, W., Gschnait, F. and Mayr, W.R. (1978) HLA B13, B17, B37 and Cw6 in psoriasis vulgaris: association with the age of onset. Arch. Dermatol. Res., 28, 337-339.

6. Tiilikainen, A., Lassus, A., Karvonen, J., Vartiainen, P. and Julin, M. (1980) Psoriasis and HLA-Cw6. Br. J. Dermatol., 102, 179-184. MEDLINE Abstract

7. Ozawa, A., Ohkido, M. and Tsuji, K. (1981) Some recent advances in HLA and skin diseases. J. Am. Acad. Dermatol., 4, 205-230. MEDLINE Abstract

8. Cao, K., Song, F.J., Li, H.G., Xu, S.Y., Liu, Z.H., Su, X.H. and Wang, F.X. (1993) Association between HLA antigens and families with psoriasis vulgaris. Chin. Med. J., 106, 132-135. MEDLINE Abstract

9. Schmitt-Egenolf, M., Eiermann, T.H., Boehncke, W.H., Stander, M. and Sterry, W. (1996) Familial juvenile onset psoriasis is associated with the human leukocyte antigen (HLA) class I side of the extended haplotype Cw6-B57-DRB1*0701-DQA1*0201-DQB1*0303: a population- and family-based study. J. Invest. Dermatol., 106, 711-714. MEDLINE Abstract

10. Moller, E. and Olhagen, B. (1975) Studies on the major histocompatibility system inpatients with ankylosing spondylitis. Tissue Antigens, 6, 237-246. MEDLINE Abstract

11. Asahina, A., Akazaki, S., Nakagawa, H., Kuwata, S., Tokunaga, K., Ishibashi, Y. and Juji, T. (1991) Specific nucleotide sequence of HLA-C is strongly associated with psoriasis vulgaris. J. Invest. Dermatol., 97, 254-258. MEDLINE Abstract

12. Mizuki, N., Ando, H., Kimura. M., Ohno. S., Miyata, S., Yamazaki, M., Tashiro, H., Watanabe, K., Ono, A., Taguchi, S., Sugawara, C., Fukuzumi, Y., Okumura, K., Goto, K., Ishihara, M., Nakamura, S., Yonemoto, J., Kikuti, Y.Y., Shiina, T., Chen, L., Ando, A., Ikemura, T. and Inoko, H. (1997) Nucleotide sequence analysis of the HLA class I region spanning the 237-kb segment around the HLA-B and -C genes. Genomics, 42, 55-66. MEDLINE Abstract

13. Shiina, T., Tamiya, G., Oka, A., Yamagata, T., Yamagata, N., Kikkawa, E., Goto, K., Mizuki, N., Watanabe, K., Fukuzumi, Y., Taguchi, S., Sugawara, C., Ono, A., Chen, L., Yamazaki, M., Tashiro, H., Ando, A., Ikemura, T., Kimura, M. and Inoko, H. (1998) Nucleotide sequencing analysis of the 146-kilobase segment around the IkBL and MICA genes at the centromeric end of the HLA class I region. Genomics, 47, 372-382. MEDLINE Abstract

14. Shiina, T., Tamiya, G., Oka, A., Takishima, N. and Inoko, H. (1999) Genome sequencing analysis of the 1.8 Mb entire human MHC class I region. Immunol. Rev., 167, 193-199. MEDLINE Abstract

15. Tamiya, G., Ota, M., Katsuyama, Y., Shiina, T., Oka, A., Makino, S., Kimura, M. and Inoko, H. (1998) Twenty-six new polymorphic microsatellite markers around the HLA-B, -C and -E loci in the human MHC class I region. Tissue Antigens, 51, 337-346. MEDLINE Abstract

16. Tamiya, G., Shiina, T., Oka, A., Ota, M., Kastuyama, Y., Tomizawa, M., Yoshitome, M., Ohtsuka, M., Kimura, M. and Inoko, H. (1999) New microsatellite markers in the human MHC class I region. Tissue Antigens, in press. MEDLINE Abstract

17. Guo, S.W. and Thompson, E.A. (1992) Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics, 48, 361-372. MEDLINE Abstract

18. Raymond, M. and Rousset, F. (1995) Genepop (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered., 86, 248-249.

19. Rousset, F. and Raymond, M. (1995) Testing heterozygote excess and deficiency. Genetics, 140, 1413-1419. MEDLINE Abstract

20. Grimaldi, M.C., Clayton, J., Pontarotti, P., Cambon-Thomsen, A. and Crouau-Roy, B. (1996) New highly polymorphic microsatellite marker in linkage disequilibrium with HLA-B.Hum. Immunol., 51, 89-94. MEDLINE Abstract

21. Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G. and Lathrop, M. (1992) A second-generation linkage map of the human genome. Nature, 29, 794-801.

22. Jenisch, S., Henseler, T., Nair, R.P., Guo, S.W., Westphal, E., Stuart, P., Kronke, M., Voorhees, J.J., Christophers, E. and Elder, J.T. (1998) Linkage analysis of human leukocyte antigen (HLA) markers in familial psoriasis: strong disequilibrium effects provide evidence for a major determinant in the HLA-B/-C region. Am. J. Hum. Genet., 63, 191-199. MEDLINE Abstract

23. Marshall, B., Leelayuwat, C., Degli-Esposti, M.A., Pinelli, M., Abraham, L.J. and Dawkins, R.L. (1993) New major histocompatibility complex genes. Hum. Immunol., 38, 24-29. MEDLINE Abstract

24. Takeda, J., Seino, S. and Bell, G.I. (1991) Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucleic Acids Res., 20, 4613-4620.

25. Krishnan, B.R., Jamry, I. and Chaplin, D.D. (1995) Feature mapping of the HLA class I region: localization of the POU5F1 and TCF19 genes. Genomics, 30, 53-58. MEDLINE Abstract

26. Ku, D.H., Chang, C.D., Koniecki, J., Cannizzaro, L.A., Boghosian-Sell, L., Alder, H. and Baserga, R. (1991) A new growth-regulated complementary DNA with the sequence of a putative trans-activating factor. Cell Growth Differ., 2, 179-186. MEDLINE Abstract

27. Zhou, Y. and Chaplin, D.D. (1993) Identification in the HLA class I region of a gene expressed late in keratinocyte differentiation. Proc. Natl Acad. Sci. USA, 90, 9470-9474. MEDLINE Abstract

28. Ishihara, M., Yamagata, N., Ohno, S., Naruse, T., Ando, A., Kawata, H., Ozawa, A., Ohkido, M., Mizuki, N., Shiina, T., Ando, H. and Inoko, H. (1996) Genetic polymorphisms in the keratin-like S gene within the human major histocompatibility complex and association analysis on the susceptibility to psoriasis vulgaris. Tissue Antigens, 48, 182-186. MEDLINE Abstract

29. Tazi Ahnini, R., Camp, N.J., Cork, M.J., Mee, J.B., Keohane, S.G., Duff, G.W. and di Giovine, F.S. (1999) Novel genetic association between the corneodesmosin (MHC S)gene and susceptibility to psoriasis. Hum. Mol. Genet., 8, 1135-1140. MEDLINE Abstract

30. Allen, M.H., Veal, C., Faassen, A., Powis, S.H., Vaughan, R.W., Trembath, R.C. and Barker, J.N. (1999) A non-HLA gene within the MHC in psoriasis. Lancet, 353, 1589-1590. MEDLINE Abstract

31. Liu, C.G., Maercker, C., Castanon, M.J., Hauptmann, R. and Wiche, G. (1996) Human plectin: organization of the gene, sequence analysis, and chromosome localization (8q24). Proc. Natl Acad. Sci. USA, 30, 4278-4283.

32. Pulkkinen, L., Smith, F.J., Shimizu, H., Murata, S., Yaoita, H., Hachisuka, H., Nishikawa, T., McLean, W.H. and Uitto, J. (1996) Homozygous deletion mutations in the plectin gene (PLEC1)in patients with epidermolysis bullosa simplex associated with late-onset muscular dystrophy. Hum. Mol. Genet., 5, 1539-1546. MEDLINE Abstract

---

+To whom correspondence should be addressed. Tel: +81 463 93 1121; Fax: +81 463 94 8884; Email: hinoko{at}is.icc.u-tokai.ac.jp

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				M Akiyama, K Yatsu, M Ota, Y Katsuyama, K Kashiwagi, F Mabuchi, H Iijima, K Kawase, T Yamamoto, M Nakamura, et al. Microsatellite analysis of the GLC1B locus on chromosome 2 points to NCK2 as a new candidate gene for normal tension glaucoma Br. J. Ophthalmol., September 1, 2008; 92(9): 1293 - 1296. [Abstract] [Full Text] [PDF]

				K. Yatsu, N. Mizuki, N. Hirawa, A. Oka, N. Itoh, T. Yamane, M. Ogawa, T. Shiwa, Y. Tabara, S. Ohno, et al. High-Resolution Mapping for Essential Hypertension Using Microsatellite Markers Hypertension, March 1, 2007; 49(3): 446 - 452. [Abstract] [Full Text] [PDF]

				T. Shiina, M. Ota, S. Shimizu, Y. Katsuyama, N. Hashimoto, M. Takasu, T. Anzai, J. K. Kulski, E. Kikkawa, T. Naruse, et al. Rapid Evolution of Major Histocompatibility Complex Class I Genes in Primates Generates New Disease Alleles in Humans via Hitchhiking Diversity Genetics, July 1, 2006; 173(3): 1555 - 1570. [Abstract] [Full Text] [PDF]

				N. Corbi, T. Bruno, R. De Angelis, M. Di Padova, V. Libri, M. G. Di Certo, L. Spinardi, A. Floridi, M. Fanciulli, and C. Passananti RNA Polymerase II subunit 3 is retained in the cytoplasm by its interaction with HCR, the psoriasis vulgaris candidate gene product J. Cell Sci., September 15, 2005; 118(18): 4253 - 4260. [Abstract] [Full Text] [PDF]

				G. Tamiya, M. Shinya, T. Imanishi, T. Ikuta, S. Makino, K. Okamoto, K. Furugaki, T. Matsumoto, S. Mano, S. Ando, et al. Whole genome association study of rheumatoid arthritis using 27 039 microsatellites Hum. Mol. Genet., August 15, 2005; 14(16): 2305 - 2321. [Abstract] [Full Text] [PDF]

				F. Capon, M. H. Allen, M. Ameen, A. D. Burden, D. Tillman, J. N. Barker, and R. C. Trembath A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups Hum. Mol. Genet., October 1, 2004; 13(20): 2361 - 2368. [Abstract] [Full Text] [PDF]

				C. A. Stewart, R. Horton, R. J.N. Allcock, J. L. Ashurst, A. M. Atrazhev, P. Coggill, I. Dunham, S. Forbes, K. Halls, J. M.M. Howson, et al. Complete MHC Haplotype Sequencing for Common Disease Gene Mapping Genome Res., June 1, 2004; 14(6): 1176 - 1187. [Abstract] [Full Text] [PDF]

				T. Sugawara, H. Shimizu, N. Hoshi, A. Nakajima, and S. Fujimoto Steroidogenic Acute Regulatory Protein-binding Protein Cloned by a Yeast Two-hybrid System J. Biol. Chem., October 24, 2003; 278(43): 42487 - 42494. [Abstract] [Full Text] [PDF]

				S. C. Barlow, R. G. Collins, N. J. Ball, C. T. Weaver, T. R. Schoeb, and D. C. Bullard Psoriasiform Dermatitis Susceptibility in Itgb2tm1Bay PL/J Mice Requires Low-Level CD18 Expression and at Least Two Additional Loci for Progression to Severe Disease Am. J. Pathol., July 1, 2003; 163(1): 197 - 202. [Abstract] [Full Text] [PDF]

				F Capon, I K Toal, J C Evans, M H Allen, S Patel, D Tillman, D Burden, J N W N Barker, and R C Trembath Haplotype analysis of distantly related populations implicates corneodesmosin in psoriasis susceptibility J. Med. Genet., June 1, 2003; 40(6): 447 - 452. [Full Text] [PDF]

				N. Yanagitani, T. Kohno, J.-G. Kim, H. Kunitoh, T. Tamura, Y. Takei, S. Tsuchiya, R. Saito, and J. Yokota Identification of D19S246 as a Novel Lung Adenocarcinoma Susceptibility Locus by Genome Survey with 10-cM Resolution Microsatellite Markers Cancer Epidemiol. Biomarkers Prev., April 1, 2003; 12(4): 366 - 371. [Abstract] [Full Text] [PDF]

				T. Takada, A. Kumanovics, C. Amadou, M. Yoshino, E. P. Jones, M. Athanasiou, G. A. Evans, and K. F. Lindahl Species-Specific Class I Gene Expansions Formed the Telomeric 1 Mb of the Mouse Major Histocompatibility Complex Genome Res., April 1, 2003; 13(4): 589 - 600. [Abstract] [Full Text] [PDF]

				M. I. McCarthy and P. Froguel Genetic approaches to the molecular understanding of type 2 diabetes Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E217 - E225. [Abstract] [Full Text] [PDF]

				N. Yanagitani, T. Kohno, N. Sunaga, H. Kunitoh, T. Tamura, S. Tsuchiya, R. Saito, and J. Yokota Localization of a human lung adenocarcinoma susceptibility locus, possibly syntenic to the mouse Pas1 locus, in the vicinity of the D12S1034 locus on chromosome 12p11.2-p12.1 Carcinogenesis, July 1, 2002; 23(7): 1177 - 1183. [Abstract] [Full Text] [PDF]

				K. Asumalahti, C. Veal, T. Laitinen, S. Suomela, M. Allen, O. Elomaa, M. Moser, R. de Cid, S. Ripatti, I. Vorechovsky, et al. Coding haplotype analysis supports HCR as the putative susceptibility gene for psoriasis at the MHC PSORS1 locus Hum. Mol. Genet., March 1, 2002; 11(5): 589 - 597. [Abstract] [Full Text] [PDF]

				J. T. Elder, R. P. Nair, T. Henseler, S. Jenisch, P. Stuart, N. Chia, E. Christophers, and J. J. Voorhees The Genetics of Psoriasis 2001: The Odyssey Continues Arch Dermatol, November 1, 2001; 137(11): 1447 - 1454. [Abstract] [Full Text] [PDF]

				K. Asumalahti, T. Laitinen, R. Itkonen-Vatjus, M.-L. Lokki, S. Suomela, E. Snellman, U. Saarialho-Kere, and J. Kere A candidate gene for psoriasis near HLA-C, HCR (Pg8), is highly polymorphic with a disease-associated susceptibility allele Hum. Mol. Genet., June 12, 2000; 9(10): 1533 - 1542. [Abstract] [Full Text] [PDF]

				M. Herr, F. Dudbridge, P. Zavattari, F. Cucca, C. Guja, R. March, R. D. Campbell, A. H. Barnett, S. C. Bain, J. A. Todd, et al. Evaluation of fine mapping strategies for a multifactorial disease locus: systematic linkage and association analysis of IDDM1 in the HLA region on chromosome 6p21 Hum. Mol. Genet., May 22, 2000; 9(9): 1291 - 1301. [Abstract] [Full Text] [PDF]

				D. W. Morris, L. Robinson, D. Turic, M. Duke, V. Webb, C. Milham, E. Hopkin, K. Pound, S. Fernando, M. Easton, et al. Family-based association mapping provides evidence for a gene for reading disability on chromosome 15q Hum. Mol. Genet., March 22, 2000; 9(5): 843 - 848. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (109) Request Permissions Google Scholar Articles by Oka, A. Articles by Inoko, H. Search for Related Content PubMed PubMed Citation Articles by Oka, A. Articles by Inoko, H. Social Bookmarking          What's this?

Online ISSN 1460-2083 - Print ISSN 0964-6906

Copyright © 2008 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary